Live cell imaging of the assembly, disassembly, and actin cable-dependent movement of endosomes and actin patches in the budding yeast, Saccharomyces cerevisiae.

Yeast strains and fluorescent protein tagging

Yeast strains used in this work are listed in Table II Table II. Strains used in this work Strain Genotype Source BY4741 MAT a his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 Research Genetics YCY027 MAT a his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 ABP140:GFP:KanMX6 This work YCY031 MAT a his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 ABP140:GFP:KanMX6 ABP1:HcRed:HIS3 This work Y4133 MATα his3 Δ 1 leu2 Δ 0 lys2 Δ 0 ura3 Δ 0 bni1-11::URA3 bnr1 Δ ::KanMX6 Evangelista et al., 2002 AGY001 MATα his3 Δ 1 leu2 Δ 0 lys2 Δ 0 ura3 Δ 0 bni1-11::URA3 bnr1 Δ ::KanMX6 ABP1:HcRed:HIS3 This work THY150 MAT a his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 ABP1:HcRed:HIS3 This work THY157 MAT a his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 ABP1:GFP:KanMX6 This work THY166 MAT a his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 SAC6:GFP:HIS3 abp1 Δ ::KanMX6 This work THY168 MAT a his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 SAC6:GFP:HIS3 This work THY169 MAT a his3 Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 ABP1:GFP:KanMX6 SAC6:HcRed:HIS3 This work YMW81 MAT a ade2-101 his3 Δ 200 leu2 Δ 1 lys2-801 trp1 Δ 63 ura3-52 arp2-1 Moreau et al., 1997 THY170 MAT a ade2-101 his3 Δ 200 leu2 Δ 1 lys2-801 trp1 Δ 63 ura3-52 arp2-1 ABP1:GFP:HIS3 This work . Yeast cell growth and manipulations were performed according to Sherman (2002) . To visualize actin cables in living cells, the COOH terminus of Abp140p was tagged with GFP(S65T) using PCR-based insertion of the GFP gene into the chromosomal copy of ABP140 as described previously ( Yang and Pon, 2002 ). To visualize actin patches in living cells, the COOH terminus of Abp1p was tagged with either GFP(S65T) or HcRed using PCR-based insertion of the gene into the chromosomal copy of ABP1 . For GFP and HcRed, the plasmids pFA6a-GFP(S65T)-kanMX6 ( Longtine et al., 1998 ) and pCY17, respectively, were amplified with the primers ABP1f1 (5′- AAAAGGTCTCTTCCCCAGCAATTATGTGTCTTTGGGCAAC CGGATCCCCGGGTTAAT-TAA-3′) and ABP1r1 (3′- ACGTAAGAATAATATAATAGCATGACGCTGACGTGTGATT GAATTCGAGCTCGTTTAAAC-3′), where the underlined sequences correspond to the sequences flanking the stop codon of ABP1 . Likewise, we tagged the chromosomal copy of SAC6 with GFP and HcRed in the same manner using the primers SAC6f1 (5′- AATTATTACTTTTATCGCTTCGTTAATGACTTTGAACAAA CGGATCCCCGGGTTAATTAA-3′) and SAC6r1 (5′- AAGCTGAGTAGAAAACAGGTTACGAAAGTTGTTTGTTGGC GAATTCGAGCTCGTTTAAAC-3′), where the underlined sequences correspond to the sequences flanking the stop codon of SAC6. To construct pCY17, the HcRed gene from pHcRed1 (CLONTECH Laboratories, Inc.) was amplified with primers containing the cut sites for PacI and AscI, digested, and ligated into the corresponding sites in pFA6a-GFP(S65T)-HIS3MX6, functionally replacing the GFP(S65T) gene with HcRed. Yeast cells were transformed with PCR products using the lithium acetate method ( Gietz et al., 1995 ). Transformants, which were positive for integration at the target locus, were validated by PCR, and the tagged constructs were visualized in cells by fluorescence microscopy (see below). The tags had no obvious effect on cell growth, actin organization, or function.

Microscopy and image analysis

For time-lapse fluorescence imaging, cells were grown in lactate medium as described previously ( Yang and Pon, 2002 ) until mid-log phase at 25°C. For labeling of endocytic vesicles and endosomal compartments, FM4-64 (Molecular Probes, Inc.) was added to cell cultures at a final concentration of 10 μM for variable amounts of time as described in the figure legends; cells were then washed twice with lactate medium. 3 μl of cell suspension was applied to a microscope slide and covered with a coverslip. Images were acquired using a microscope (model E600; Nikon) equipped with a Plan-Apo 100×/1.4 NA objective, a cooled charge-coupled device camera (Orca-ER; Hamamatsu), and a Dual-View image splitter (Optical Insights) for simultaneous two-color imaging. The temperature of the objective lens was controlled by an objective heater (Bioptechs). To acquire 3D images over time, optical sections were obtained at 0.4-μm steps via a piezoelectric focus motor mounted on the objective lens (Polytech PI). Images were collected and analyzed using Openlab 3.1.5 software (Improvision) and ImageJ 1.30, respectively. QuickTime movies were made from time-lapse images using Volocity 2.6 (Improvision). For determination of the velocity of actin patches and elongating actin cables, the fluorescent movements of actin patches or fiduciary marks on elongating cables were measured as a function of time, as described previously ( Smith et al., 2001 ; Yang and Pon, 2002 ). Online supplemental material Wild-type haploid cells expressing Abp1p-HcRed and Abp140p-GFP from the chromosomal loci were grown to mid-log phase in lactate medium at RT. 3 μl of cell suspension was applied to a microscope slide and covered with a coverslip. Images were acquired using a microscope (model E600; Nikon) equipped with a Plan-Apo 100×/1.4 NA objective, a cooled charge-coupled device camera (Orca-ER; Hamamatsu), and a Dual-View image splitter (Optical Insights) for simultaneous two-color imaging. Images were collected and analyzed using Openlab 3.1.5 software (Improvision) and ImageJ 1.30, respectively. QuickTime movies were made from time-lapse images using Volocity 2.6 (Improvision). Online supplemental material available at http://www.jcb.org/cgi/content/full/jcb.200404173/DC1 .

Online supplemental material Wild-type haploid cells expressing Abp1p-HcRed and Abp140p-GFP from the chromosomal loci were grown to mid-log phase in lactate medium at RT. 3 μl of cell suspension was applied to a microscope slide and covered with a coverslip. Images were acquired using a microscope (model E600; Nikon) equipped with a Plan-Apo 100×/1.4 NA objective, a cooled charge-coupled device camera (Orca-ER; Hamamatsu), and a Dual-View image splitter (Optical Insights) for simultaneous two-color imaging. Images were collected and analyzed using Openlab 3.1.5 software (Improvision) and ImageJ 1.30, respectively. QuickTime movies were made from time-lapse images using Volocity 2.6 (Improvision). Online supplemental material available at http://www.jcb.org/cgi/content/full/jcb.200404173/DC1 .