Inhibitors of phosphatidylinositol 3′-kinases promote mitotic cell death in HeLa cells.

Cell lines and treatment

HeLa cells and MEF atg5−/−, atg5+/+ cells (a generous gift from Dr. Noboru Mizushima, Tokyo Metropolitan Institute of Medical Science) were cultured in DMEM supplemented with 10% fetal bovine serum and 1% non-essential amino acids (Invitrogen). H2B-mCherry-positive or GFP-LC3-positive HeLa cells were obtained as follows. Cells were grown in a 24-well plate (3×10 4 cells per well) for 24 hours and transfected with pBOS-H2BmCherry (mCherry expressing vector was a generous gift from Dr. Chenbei Chang, University of Alabama at Birmingham) or pEGFP-LC3 (kindly provided by Dr. Longping Wen, University of Science a nd Technology of China) using Lipofectamine 2000 transfection reagent (Invitrogen 11668-027). Thirty hours after transfection, the cells were inoculated into 60-mm tissue culture dishes and selected with 2 µg/ml blasticidin S (MP Biomedicals, 150477) or 500 µg/ml G418 (GIBCO, 11811-031) for 2 or 3 weeks. All incubations were performed at 37°C in a humidified atmosphere of 5% CO 2 and 95% air. 3-MA, which was found to inhibit autophagy at concentrations ranging from 1 to 10 mM [20] , was purchased from Sigma Aldrich (Cat. No. 08592), and was directly dissolved into the culture medium at the indicated concentrations. Wortmannin (Beyotime, S1952), nocodazole (Calbiochem, 487928) and z-VAD (Calbiochem, 627610) were dissolved in DMSO and diluted in culture medium.

Cell viability assay

Cell viability was determined by a trypan blue exclusion assay. Briefly, both adherent and floating cells were collected and suspended in phosphate buffered saline (PBS, pH 7.4) at a final density of 1–2×10 6 /ml. An equal volume of 0.4% trypan blue solution (w/v, in PBS) was added to the cell suspension and mixed thoroughly. After incubation at room temperature for 3 min, cell counting was performed using a hemacytometer.

Live cell imaging

Cells were seeded in an 8-well coverglass-bottomed chamber (Lab-Tek II, Cat No. 155409) for 24 hours (6×10 3 cells per well). Images were acquired automatically at multiple locations on the coverglass using a Nikon TE2000E inverted microscope fitted with a 20× Nikon Plan Apo objective, a linearly-encoded stage (Proscan, Prior) and a Hamamatsu Orca-ER CCD camera. A mercury-arc lamp with two neutral density filters (for a total 128-fold reduction in intensity) was used for fluorescence illumination. The microscope was controlled using NIS-Elements Advanced Research software (Nikon) and housed in a custom-designed 37°C chamber with a secondary internal chamber that delivered humidified 5% CO 2 . Fluorescence and differential interference contrast images were obtained every 10 min for a period of 48 hours. To analyze live cell imaging movies, the time-lapse records of live cell imaging experiments were exported as an image series, and analyzed manually using NIS-Elements Advanced Research software (Nikon). The criteria for analyses were described previously [38] , and lagging chromosomes in prometaphase were defined as the red fluorescence-positive materials that lingered outside the roughly formed metaphase plate for more than 3 frames (30 min). RNA interference siRNAs targeting beclin1 mRNA ( 5′- CAGUUUGGCACAAUCAAUAUU -3′ ) and nonspecific control siRNAs (GenePharma, Shanghai) were used in the following experiments. Transfection was performed using Lipofectamine 2000 (Invitrogen 11668-027). One day prior to transfection, the cells were plated at an appropriate density to grow to 70%–80% confluency overnight. siRNA-Lipofectamine 2000 complexes were then prepared, and transfection was performed according to the manufacturer's instructions. The cells were incubated with siRNA-liposome complexes for 6 hours and then provided with fresh DMEM containing 10% FBS. Transient transfection of HeLa cells with GFP and GFP-Akt expression vectors HeLa cells that had reached 70%–80% confluency were transfected with pLEGFP-N1 and pLEGFP-AKT (a generous gift from Dr. Yizheng Wang, Chinese Academy of Science) using Lipofectamine 2000 (Invitrogen 11668-027) according to the manufacturer's instructions. Twenty-four hours post-transfection, the cells were seeded into an 8-well coverglass-bottomed chamber (Lab-Tek II, Cat No. 155409) for additional treatment.

Western blotting

Antibodies specific for Beclin1 (Santa Cruz, SC11427), Atg5 (a generous gift from Dr. Hans-Uwe Simon, University of Bern), LC3 (Novus Biologicals, NB100-2220), Caspase3 (Beyotime, AC031) and β-actin (Abcam, ab8226) were used. Western blot analysis was performed as described previously (25). Proteins were extracted from HeLa cells with lysis buffer (50 mM Tris (pH 7.4), 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS and 1 mM PMSF). Equal amounts of protein (20 µg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (12% separating gel). After electrophoresis, the proteins were transferred to nitrocellulose membranes (200 mA for 3 hours). The blots were then blocked in 5% nonfat dry milk solution for 1 hour at room temperature.The membrane were incubated with the respective primary antibodies at room temperature and then with anti-rabbit or anti-mouse alkaline phosphatase-conjugated secondary IgG antibodies. Immune complexes were detected with an enhanced chemiluminescence detection method by immersing the blots in chemiluminescence reagents (Pierce 34150) for 5–10 min and then exposing the blotsto Kodak X-OMAT film for a few seconds. Statistical analysis The Student's-t test was used to compare continuous variables and the chi-squared (2×2χ2) test was used to compare categorical variables. The p-values were as shown and less than 0.05 was considered statistically significant.

Supporting Information Movie S1 Normal cell division. The cell rounded up and the chromatins became condensed and congressed onto the metaphase plate during prometaphase. The chromosomes were then segregated and decondensed to form two daughter nuclei during anaphase and telophase, generating two daughter cells. (AVI) Click here for additional data file. Movie S2 Interphase cell death. The cell underwent mitosis and produced two daughter cells. One daughter cell died before entering the next round of mitosis. (AVI) Click here for additional data file. Movie S3 Mitotic cell death. The cell rounded up as the chromatin began to condense and congress to form a metaphase plate, then the cell died without entering anaphase. (AVI) Click here for additional data file. Movie S4 Prolonged duration in prometaphase. This cell entered mitosis and stayed in mitosis for many frames (10 min/frame). (AVI) Click here for additional data file. Movie S5 Lagging chromosomes. This cell entered mitosis but stayed in prometaphase, with the red fluorescent-positive materials observed outside the roughly formed metaphase plate. (AVI) Click here for additional data file. Movie S6 Nocodazole induced mitotic cell death. The cell entered mitosis and stayed in mitosis for a prolonged period without forming a metaphase plate before committing to death. (AVI) Click here for additional data file. Movie S7 Nocodazole-induced mitotic slippage. The cell entered mitosis and stayed in mitosis for a prolonged period, and then decondensed its chromosomes without undergoing anaphase. One daughter cell was finally formed in interphase. (AVI) Click here for additional data file.