Abstract
The mouse spinal cord is an important site for autoimmune and injury models. Skull thinning surgery provides a minimally invasive window for microscopy of the mouse cerebral cortex, but there are no parallel methods for the spinal cord. We introduce a novel, facile and inexpensive method for two-photon laser scanning microscopy of the intact spinal cord in the mouse by taking advantage of the naturally accessible intervertebral space. These are powerful methods when combined with gene-targeted mice in which endogenous immune cells are labeled with green fluorescent protein (GFP). We first demonstrate that generation of the intervertebral window does not elicit a reaction of GFP(+) microglial cells in CX3CR1(gfp/+) mice. We next demonstrate a distinct rostrocaudal migration of GFP(+) immune cells in the spinal cord of CXCR6(gfp/+) mice during active experimental autoimmune encephalomyelitis (EAE). Interestingly, infiltration of the cerebral cortex by GFP(+) cells in these mice required three conditions: EAE induction, cortical injury and expression of CXCR6 on immune cells.
🔬 Techniques
💻 Software
✨ Fluorophores
🧪 Sample Preparation
🔬 Cell Lines
🧪 Reagent Suppliers
💻 Software Details
🏛️ Research Organizations (ROR)
Affiliated research institutions:
📋 Methods
2.1. Transgenic mice CXCR6 +/ gfp , CXCR6 gfp/gfp and CX 3 CR 1 +/ gfp , and LysM gfp/+ mice were a gift of D.R. Littman (NYU School of Medicine, New York, NY) ( Jung et al., 2000 ; Geissmann et al., 2005 ) and Thomas Graf (AECOM, Bronx, NY)( Faust et al., 2000 ), respectively. All strains were backcrossed onto C57BL/6 for at least 12 generations and housed in specific pathogen-free conditions in accordance with Institutional Animal Care and Use Committee protocols of New York University School of Medicine. 2.2. Peptides The Dana-Farber Cancer Institute Molecular Biology Core Facility (Boston, MA) synthesized peptides. 2.3. Quantitative PCR We perfused anaesthetized mice with PBS containing 2 mM EDTA. We isolated brain and spinal cord and snap froze in liquid Nitrogen and stored in −80 °C until further processing. We isolated RNA from tissue with TRIzol (InVitrogen, Carlsbad, CA), and treated with DNase I from which we generated cDNA using Superscript III enzyme system (InVitrogen) and amplified with ABI 7900 cycler (Applied Biosystems, Foster City, CA). The primer and probe oligonucleotides used for CXCL16 were, cxcl16-forward, ggaagccaagaccagtgggt, cxcl16reverse, tttggtggtgaaaactcttccc and cxcl16 probe, [6-fam]ttgagcgcaaagagtgtggaactggtc[TAMRA]. We used HPRT and G6PD for internal control housekeeper genes, HPRT-forward, aggttgcaagcttgctggt, HPRT-reverse, tgaagtactcattatagtcaagggc, and HPRT probe, [5TET]tgttggatacaggccagactttgttggat[TAMRA], and G6PD-forward, tgaagctccctgatgcctat, G6PD-reverse, caatcttgtgcagcagtggt, and G6PD probe [5TET]gaagcctggcgtatcttccac[TAMRA]. Cycle temperatures were 50°C for 2 min, 95°C for 2 min, 40 cycles of 95°C for 15 seconds and 60°C for 30 seconds. We performed melting curve analyses at the genomics core facility of the NYU Cancer Institute. 2.4. Surgery and experimental procedures 2.4.1. EAE We induced classical EAE with MOG peptide in CFA and pertussis toxin ( Mendel et al., 1995 ). Briefly, we injected 100 μg MOG (35-55) peptide (MEVGWYRSPFSRVVHLYRNGK) emulsified in CFA with heat killed mycobacterium tuberculosis (4 mg/ml) at the base of the tail on day 0 and pertussis toxin (100 ng in sterile saline) into the tail vein on days 0 and 2. We scored mice for EAE as follows: 0, no disease; 1, tail paralysis; 2, hind limb weakness; 3, hind limb paralysis; 4, fore limb weakness; 5, moribund. We hydrated mice with scores >2 daily and sacrificed for score ≥ 4. 2.4.2. Thinned skull and laser injury In all the intravital imaging described below, we maintained anesthetized mice on warming plates and the intravital window through an objective heater to maintain core temperature at 37°C. We performed thinned skull intravital window surgeries and laser ablation as previously described ( Grutzendler et al., 2002 ; Davalos et al., 2005 ). The size of injury induced was typically ~15 μm in diameter. We defined vascular spaces by intravenous injection of 655 nm emitting quantum dots (R&D Systems, Minneapolis, MN). 2.4.3. Intravital spinal cord (See Figure 1 and Results (3.1) for details of the method.) We anesthetized mice and exposed the thoracic spine by dissecting the overlying muscle and connective tissue. We bent a thin stainless steel plate with an open central slot to separate the inner edges of the plate to engage two adjacent vertebrae in a funnel clamp and then immobilized the plate by attaching it to two posts using screws. We then acquired Images through the thinned intervertebral connective tissue sealed above with 2% low melting agarose (Sigma, St. Louis, MO) and a cover glass over the area. 2.5. Two photon microscopy We tuned a mode locked Ti-Sapphire laser (Spectraphysics) connected to a Bio-Rad Radiance multiphoton microscope to 920 nm to excite GFP and quantum dots ( Shakhar et al., 2005 ), and acquired stacks of images using step sizes of 1–3 μm to a depth of 200 μm bellow the skull using ×40 or ×60 water dipping objectives. We then generated time-lapse movies with 1- to 1.5-min intervals between 3D stacks. 2.6.
Show full methods section
2.1. Transgenic mice CXCR6 +/ gfp , CXCR6 gfp/gfp and CX 3 CR 1 +/ gfp , and LysM gfp/+ mice were a gift of D.R. Littman (NYU School of Medicine, New York, NY) ( Jung et al., 2000 ; Geissmann et al., 2005 ) and Thomas Graf (AECOM, Bronx, NY)( Faust et al., 2000 ), respectively. All strains were backcrossed onto C57BL/6 for at least 12 generations and housed in specific pathogen-free conditions in accordance with Institutional Animal Care and Use Committee protocols of New York University School of Medicine. 2.2. Peptides The Dana-Farber Cancer Institute Molecular Biology Core Facility (Boston, MA) synthesized peptides. 2.3. Quantitative PCR We perfused anaesthetized mice with PBS containing 2 mM EDTA. We isolated brain and spinal cord and snap froze in liquid Nitrogen and stored in −80 °C until further processing. We isolated RNA from tissue with TRIzol (InVitrogen, Carlsbad, CA), and treated with DNase I from which we generated cDNA using Superscript III enzyme system (InVitrogen) and amplified with ABI 7900 cycler (Applied Biosystems, Foster City, CA). The primer and probe oligonucleotides used for CXCL16 were, cxcl16-forward, ggaagccaagaccagtgggt, cxcl16reverse, tttggtggtgaaaactcttccc and cxcl16 probe, [6-fam]ttgagcgcaaagagtgtggaactggtc[TAMRA]. We used HPRT and G6PD for internal control housekeeper genes, HPRT-forward, aggttgcaagcttgctggt, HPRT-reverse, tgaagtactcattatagtcaagggc, and HPRT probe, [5TET]tgttggatacaggccagactttgttggat[TAMRA], and G6PD-forward, tgaagctccctgatgcctat, G6PD-reverse, caatcttgtgcagcagtggt, and G6PD probe [5TET]gaagcctggcgtatcttccac[TAMRA]. Cycle temperatures were 50°C for 2 min, 95°C for 2 min, 40 cycles of 95°C for 15 seconds and 60°C for 30 seconds. We performed melting curve analyses at the genomics core facility of the NYU Cancer Institute. 2.4. Surgery and experimental procedures 2.4.1. EAE We induced classical EAE with MOG peptide in CFA and pertussis toxin ( Mendel et al., 1995 ). Briefly, we injected 100 μg MOG (35-55) peptide (MEVGWYRSPFSRVVHLYRNGK) emulsified in CFA with heat killed mycobacterium tuberculosis (4 mg/ml) at the base of the tail on day 0 and pertussis toxin (100 ng in sterile saline) into the tail vein on days 0 and 2. We scored mice for EAE as follows: 0, no disease; 1, tail paralysis; 2, hind limb weakness; 3, hind limb paralysis; 4, fore limb weakness; 5, moribund. We hydrated mice with scores >2 daily and sacrificed for score ≥ 4. 2.4.2. Thinned skull and laser injury In all the intravital imaging described below, we maintained anesthetized mice on warming plates and the intravital window through an objective heater to maintain core temperature at 37°C. We performed thinned skull intravital window surgeries and laser ablation as previously described ( Grutzendler et al., 2002 ; Davalos et al., 2005 ). The size of injury induced was typically ~15 μm in diameter. We defined vascular spaces by intravenous injection of 655 nm emitting quantum dots (R&D Systems, Minneapolis, MN). 2.4.3. Intravital spinal cord (See Figure 1 and Results (3.1) for details of the method.) We anesthetized mice and exposed the thoracic spine by dissecting the overlying muscle and connective tissue. We bent a thin stainless steel plate with an open central slot to separate the inner edges of the plate to engage two adjacent vertebrae in a funnel clamp and then immobilized the plate by attaching it to two posts using screws. We then acquired Images through the thinned intervertebral connective tissue sealed above with 2% low melting agarose (Sigma, St. Louis, MO) and a cover glass over the area. 2.5. Two photon microscopy We tuned a mode locked Ti-Sapphire laser (Spectraphysics) connected to a Bio-Rad Radiance multiphoton microscope to 920 nm to excite GFP and quantum dots ( Shakhar et al., 2005 ), and acquired stacks of images using step sizes of 1–3 μm to a depth of 200 μm bellow the skull using ×40 or ×60 water dipping objectives. We then generated time-lapse movies with 1- to 1.5-min intervals between 3D stacks. 2.6.
Data analysis
We used Volocity software (Improvision, Waltham, MA) to track T cell movements. We obtained cell counts within three-dimensional volumes to calculate cells/mm 3 . We determined average speed by using mean value of instantaneous speeds spanning 20-30 min. Confinement index is the ratio of displacement to path length with a range of 0 to 1. Immobile fraction is the percent of cells with average displacement rate of < 1 μm/min over a 30 min interval and can be visualized as cells whose movements are confined within a maximum confinement radius of 30 μm ( Sims et al., 2007 ). One-dimensional motility coefficient is the square of mean displacement divided by 2t 1/2 ( Adachi et al., 2003 ; Sumen et al., 2004 ). We determined statistical significance ( p < 0.05) using a Student’s t test and a Mann-Whitney rank sum test for populations with non-Gaussian distributions.
2.4. Surgery and experimental procedures 2.4.1. EAE We induced classical EAE with MOG peptide in CFA and pertussis toxin ( Mendel et al., 1995 ). Briefly, we injected 100 μg MOG (35-55) peptide (MEVGWYRSPFSRVVHLYRNGK) emulsified in CFA with heat killed mycobacterium tuberculosis (4 mg/ml) at the base of the tail on day 0 and pertussis toxin (100 ng in sterile saline) into the tail vein on days 0 and 2. We scored mice for EAE as follows: 0, no disease; 1, tail paralysis; 2, hind limb weakness; 3, hind limb paralysis; 4, fore limb weakness; 5, moribund. We hydrated mice with scores >2 daily and sacrificed for score ≥ 4. 2.4.2. Thinned skull and laser injury In all the intravital imaging described below, we maintained anesthetized mice on warming plates and the intravital window through an objective heater to maintain core temperature at 37°C. We performed thinned skull intravital window surgeries and laser ablation as previously described ( Grutzendler et al., 2002 ; Davalos et al., 2005 ). The size of injury induced was typically ~15 μm in diameter. We defined vascular spaces by intravenous injection of 655 nm emitting quantum dots (R&D Systems, Minneapolis, MN). 2.4.3. Intravital spinal cord (See Figure 1 and Results (3.1) for details of the method.) We anesthetized mice and exposed the thoracic spine by dissecting the overlying muscle and connective tissue. We bent a thin stainless steel plate with an open central slot to separate the inner edges of the plate to engage two adjacent vertebrae in a funnel clamp and then immobilized the plate by attaching it to two posts using screws. We then acquired Images through the thinned intervertebral connective tissue sealed above with 2% low melting agarose (Sigma, St. Louis, MO) and a cover glass over the area.
Supplementary Material 01 02 Movie 1: Spinal cord T cell migration pattern. Movement of GFP + T cells in spinal cord of live CXCR6 gfp/+ and CXCR6 gfp/gfp mice with EAE score 2 (day 14). GFP + cells are shown in white and the vasculature, in red. The large blood vessel is posterior spinal vein. Tracks of the GFP + cells are outlined from 30 minute time lapse movie. First part of the movie corresponds to Fig. 3 A, B . Scale bar = 50 μm. 03 Movie 2: CXCR6 dependent T cell recruitment into gray matter. GFP + cell recruitment to cerebral cortex of CXCR6 gfp/+ mice with EAE. All parts are TPLSM with 40× objective through thinned skull. Parts 1 and 2- GFP + cells recruit to the injury focus in the gray matter in a swarming motion. The segment runs twice with close ( 50 μm) cells tracked. Part 3- In the absence of injury the GFP + cells are restricted to move within the meninges and perivascular spaces. Movie parts correspond to Fig. 5 A, B . Scale bar = 50 μm.
📊 Figures
Figure 1
Intervertebral intravital window
(A) 2-3 dulled razor blades are cemented together to produce a more stable steel plate. Inner wings of the blade are bent to serve as funnel clamps. (B) This bent plate is then inserted on either side...
Figure 2
CXCR6 and EAE course
(A) CXCR6 did not affect the course of EAE at the onset, active (days 0-15) and remission phases (days 20-52) (scores u00b1 s.d) for C57BL/6 WT (n=10) CXCR6 gfp/+ (n=29) and CXCR6 gfp/gfp mice (n=22) ...
Figure 3
Spinal cord T cell dynamics in EAE determined by TPSLM
(A& B) Representative intravital spinal cord 2-photon images from both sides of the posterior spinal vein of a CXCR6 gfp/+ mouse at day 14 of EAE. GFP + cells are shown in white and the vasculature, i...
Figure 4
CXCR6 dependent recruitment of T cell into injured brain in EAE
The images are all 3D reconstructions that include the thinned skull (blue) the vasculature (red) and the GFP + T cells (green). (A) Area around a laser injury in a CXCR6 gfp/+ mouse with laser injury...
Figure images are served from the NIH/NLM PubMed Central Open Access Subset or Europe PMC; copyright remains with the publishers and authors.
💬 Discussion
0 commentsNo comments yet. Be the first to start a discussion!
Leave a Comment