A presynaptic ENaC channel drives homeostatic plasticity.

Electrophysiology

Recordings were made from muscle 6 in abdominal segments 2 and 3 from third instar larvae, as previously described ( Frank et al., 2006 , 2009 , Müller et al, 2012 ). Recordings were made in HL3 saline containing (in mM): 70 NaCl, 5 KCl, 10 MgCl 2 , 10NaHCO 3 , 115 Sucrose, 4.2 trehalose, 5 HEPES, and 0.35 CaCl 2 , unless otherwise specified. Quantal content was calculated by dividing the average EPSP amplitude by the average mEPSP amplitude, for each muscle recording. Where specified, quantal content was corrected for nonlinear summation (NLS), according to established methods ( Martin et al., 1955 ; Davis and Goodman, 1998 ) For acute pharmacological homeostatic challenge, larvae were incubated in Philanthotoxin-433 (PhTx; 10-20μM; Sigma-Aldrich) for 10 minutes ( Frank et al., 2006 ). Benzamil hydrochoride hydrate (Sigma-Aldrich) was prepared as a stock in H 2 O, and diluted to the desired concentration in HL3 saline. EIPA (5-(n-ethyl-n-isopropyl)amiloride; Sigma-Aldrich) was prepared as a stock in DMSO, then diluted 1:1000 in HL3 for to a concentration of EIPA of 20μM. A 1:1000 dilution of DMSO is without effect on synaptic transmission ( Frank et al., 2006 ). Two-electrode voltage clamp recordings were done as previously described ( Müller et al, 2012 ). All recordings were made from muscle 6 in abdominal segments 2 and 3 from third instar larvae in HL3 saline with 1mM CaCl 2 . mEPSPs were recorded with the amplifier in bridge mode before switching to TEVC mode. mEPSPs were analyzed rather than mEPSCs, because of the low signal to noise ratio for mEPSCs. EPSC analysis was conducted using custom-written routines for Igor Pro 5.0 (wavemetrics), and mEPSPs were analyzed using Mini Analysis 6.0.0.7 (Synaptosoft).

Fly Stocks and Genetics

In all experiments, the w 1118 strain was used at the wild-type control, and animals were raised at 22°C, unless otherwise noted. Drosophila melanogaster stocks with the following mutations, UAS -transgenes, or GAL4 drivers were used in the course of this study: UAS-ppk11-RNAi , UAS-ppk11-dn , and UAS-ppk19-RNAi , were the kind gifts of Lei Liu. ppk11 Mi , ppk11 PBac , ppk16 Mi , and Df(2l)BSC240 (PPK deficiency) were acquired from the Bloomington stock center. UAS-ppk16-RNAi was acquired from the Vienna Stock Center (VDRC transformant ID 22990). The GluRIIA SP16 null mutation ( Petersen et at., 1997 ), the OK371-GAL4 driver (Mahr and Aberle, 2005), and the MHC-Gal4 driver ( Schuster et al., 1996 ) have all been previously reported on. The precise excision, ppk11 Precise , and the imprecise excision, ppk16 166 , were generated according to standard procedures ( Metaxakis et al., 2005 .). Deletions were identified by PCR, and all results were verified through sequencing.

Anatomical Analysis

Third-instar larval preparations were fixed in Bouin’s fixative, washed, and incubated overnight at 4°C in primary antibodies. Secondary antibodies were applied at room temperature for 2hrs. The following antibodies were used: anti-NC82 (1:100; mouse; Developmental Studies Hybridoma Bank), and anti-DLG (1:10,000; rabbit). Alexa conjugated secondary antibodies and Cy5-conjugated goat ant-HRP were used at 1:250 (Jackson Immunoresearch Laboratories; Molecular Probes). Larval preparations were mounted in Vectashield (Vector) and imaged at room temperature using an Axiovert 200 (Zeiss) inverted microscope, a 100X Plan Apochromat objective (1.4NA), and a cooled CCD camera (Coolsnap HQ, Roper). Intelligent Imaging Innovations (3I) software was used to capture, process, and analyze images. CNS Quantitative RT-PCR RT-PCR was performed as previously described ( Bergquist et al., 2010 ). Primer-probes specific for real-time PCR detection of ppk11 , ppk16 , and Ribosomal protein L32 ( RpL32 ) were designed and developed by Applied Biosystems. The CNS was removed from 25 third-instar larvae per sample (3 samples/genotype). Total RNA was isolated from each sample using the standard Trizol protocol. A DNase digestion removed potential DNA contamination (RQ1 RNAse-free DNase Promega). cDNA extraction and amplification cDNA libraries were generated using the SMARTer RACE cDNA Amplification Kit (Clontech). Primers used for PPK11 and PPK16 amplification were as follows: ppk11 forward, atgtccgacgttccaggag; ppk11 reverse, attagccggccctaatgacc; ppk16 forward, atggctttcaagaagcggcg; ppk16 reverse, ctactcccggttgatgtagtt. PCR was done using TAQ polymerase, according to standard procedures. Calcium Imaging Ca 2+ imaging experiments were done as described in Müller and Davis (2012) . See supplemental methods for details regarding dissection, dye loading and imaging.

Supplementary Material 01