Cancer Cells Upregulate NRF2 Signaling to Adapt to Autophagy Inhibition.

Detailed methods are provided in the online version of this paper and include the following: LEAD CONTACT AND MATERIALS AVAILABILITY Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Andrew Thorburn ( andrew.thorburn@ucdenver.edu ). This study did not generate new unique reagents other than guide RNAs and all sequences are provided in Table S1 . EXPERIMENTAL MODEL AND SUBJECT DETAILS Cell Lines All Cell lines were maintained at 37C and 5 % CO 2 . HCT116 (male) cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM) with 10 % fetal bovine serum (FBS). MCF7 (female) cells were maintained in Minimum Essential Media (MEM) with 10 % FBS and Insulin (0.01 mg/ml). BT549 (Female) cells were maintained in Roswell Park Memorial Institute medium (RPMI 1640) with 10 % FBS and Insulin (7.5 mg/ml). MDA-MB-468 (female) were maintained in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 with 10% FBS. NCIH292 (female), SJSA-1 (male), and NCIH1650 (male) cells were maintained in Roswell Park Memorial Institute medium (RPMI 1640) with 10 % FBS. MAF-794 were maintained in Optimem medium with 15% FBS. The HT1080 (male) cells were maintained in Minimum Essential Media (MEM) with Non-essential amino acids and sodium pyruvate. For experiments with galactose, RPMI 1640 media without glucose was supplemented with 10 mM galactose, 10% FBS, and 7.5 mg/ml insulin. NCIH-1650 cell lines with stable expression of ATG7 were made by transfecting PCDA3-EV or PCDNA3 containing human ATG7 isoform A, and then selected with hygromycin. All cell lines were maintained in penicillin streptomycin while in culture and periodically monitored for mycoplasma contamination. All cell lines were fingerprinted by short-tandem repeat profiling to confirm identity. Animal Studies All animal studies were performed in accordance with and approval by the Institutional Animal Care and Use Committee at Colorado State University. 6–8 week old female athymic nude (nu/nu) mice were purchased from The Jackson Laboratory, and housed in microisolator cages in the laboratory animal facility at Colorado State University. 2 × 10 6 H292 wild-type, or Atg7 −/− cells were injected subcutaneously into the right dorsal flank of mice in 100 mL of serum free RPMI media. Tumor volume was measured daily in a blinded fashion with digital calipers using the formula short diameter 2 × long diameter × 0.5. Once tumors reached 150 mm 3 , mice were randomized to vehicle control (0.9% saline) or hydroxychloroquine (HCQ) treatment groups, and treatment with 60 mg/kg HCQ, i.p. daily in 100 mL injection volume of 0.9% saline was initiated. Mice were weighed every other day for drug dosage calculations and sacrificed after 10% weight loss, or when tumor volume reached 1500 mm 3 . METHOD DETAILS CRISPR with RNPs Each guide RNA (gRNA) was created by first running a nested PCR to generate a PCR template that contains the T7 sequence adjacent to a 20 base pair gRNA target sequence (designed using crispr.mit.edu ) and a tracer RNA region according to previous reports ( Liang et al., 2015 ). Specifically, an initial PCR reaction was used to amplify the tracer RNA from 20 ng of lentiCRISPRV2 plasmid using GTTTTAGAGCTAGAAATAGCAAG and AAAAGCACCGACTCGGTGCCAC oligonucleotides at 0.5 mM each and 0.5 ml of Phusion High Fidelity DNA Polymerase in a 50-ml reaction. Thermal cycles programed for 2 minutes at 98C for initial denaturation, followed by 35 cycles of 30 seconds at 98C for denaturation, 30 seconds at 55C as annealing, and 30 seconds at 72C for elongation and a final extension of 5 minutes at 72C. PCR products were examined by electrophoresis at 100–120 Volz for approximately 30 minutes in a 1% (w/v) agarose gel in 1x TAE buffer and the size was confirmed with a 1 KB DNA ladder. PCR products were purified with the Wizard SV Gel PCR clean up kit and eluted in 30 ml of RNAse/DNase free H 2 O. Subsequent nested PCRs were then amplified off of 17 ng of this product using a T7 FWD primer (TAATACGACTCACTATAG) and TrcRNA REV primer (AAAAGCACCGA CTCGGTGCCAC) each at 0.5 mM along with a Forward and Reverse primer corresponding to each specific gRNA sequence at 1.5 nM (see Oligos in Table S2 ) in a 50-ml reaction with 0.5 ml of Phusion High Fidelity DNA Polymerase. Thermal cycles programed for 2 minutes at 98C for initial denaturation, followed by 35 cycles of 30 seconds at 98C for denaturation, 30 seconds at 55C as annealing, and 30 seconds at 72C for elongation and a final extension of 5 minutes at 72C. PCR products were examined by electrophoresis at 100–120 Volz for approximately 30 minutes in a 1% (w/v) agarose gel in 1x TAE buffer and the size was confirmed with a 1 KB DNA ladder. PCR products were cleaned up with the Wizard SV Gel PCR clean up kit and eluted in 30 ml of RNase/DNase free H 2 O. 500 ng of each guide RNA template was then subject to In-vitro transcription with a MEGAshortscript T7 transcription kit according to manufactures instructions and incubated for 4 hrs at 36.5C followed by a 15-minute incubation with DNase treatment at 36.5C. The transcribed RNA was cleaned up with the MEGAclear transcription clean-up kit and eluted in 100 ml of elution buffer warmed to 98C. RNA concentration and purity was calculated with a nanodrop machine. RNA was then diluted to 10 ng/ml in RNase/DNase free H 2 O in single use aliquots and frozen at −80C. Five individual gRNAs were transcribed per gene and then tested for editing ability via an in-vitro Cas9 assay. Specifically, the region of DNA (300–600 base pairs) predicted to be cut was amplified from expression plasmids or cDNA via a standard PCR reaction. 60 ng of target PCRs were then incubated for 1 hr at 37 with bovine serum albumin (BSA), NEB Buffer #3, 100 ng of a single guide RNA and 150 ng of recombinant Cas9 protein from PNAbio. PCR products with and without Cas9 were examined by electrophoresis at 100–120 Volts for approximately 30–60 minutes in a 1% (w/v) agarose gel in 1x TAE buffer and the size was confirmed with a 1 KB DNA ladder. Based on their ability to edit in vitro and predicted off target binding 2 guide RNAs were chosen per gene to transfect into cells. Specifically, 200 ng of recombinant Cas9 (PNAbio) was incubated for 10 minutes with 5 ng of each guide RNA (two that target GFP and two that target the gene of interest). 7.4 ml of Opti-MEM reduced serum medium was then added to the eppendorf tubes along with 0.4 ml of Cas9 Plus Reagent (from the Lipofectamine CRISPR Max kit transfection kit) and allowed to incubate for another 10 minutes at room temperature. Simultaneously in separate eppendorf tubes 9.7 ml of Opti-MEM was incubated with 0.3 ml of CRISPRMAX reagent for 10 minutes at room temperature. The Cas9 plus incubation was then added to the CRISPRMAX incubation and allowed to incubate together for 15 minutes at room temperature. 20 ml of the transfection was added to each individual well of a 96 well plate where cells (mCherry + /GFP + ) were seeded at 500–1000 cells per well in 100 ml in triplicate wells the previous day and allowed to incubate for 4.5 hours at 37C and 5% CO 2 . The media was then dumped off and 200 ml of full medium was added back to each well, and plates were monitored by Incucyte live cell imaging for 7–10 days with images taken every 2–4 hours. Medium was replaced as needed every 3–4 days. For each cell line gRNAs targeting essential and non-essential genes were tested in parallel in triplicate wells on each 96 well plate and used for normalization. Oligonucleotoides used to design guide RNAs are located in Table S2 .

Incucyte Live Cell Imaging

Live cell imaging was performed with an Incucyte (dual color model 4459) at 4X magnification and images in the red and green channel were taken every 2–4 hours (for figure presentation, quantification ever 8–12 hours is shown). For mCherry cell count, mCherry + cells/mm 2 were masked (and optimized for each cell type). For caspase 3/7 activity: CellEvent Caspase 3/7 green reagent was added (2 mM) at the same time as drug and green events were masked (and optimized for each cell type). Green count/mm 2 was then normalized to red count/mm 2 to normalize for cell number at every time point. For quantification of GFP − cell count during the Live-cell CRISPR assay: the overlap mask (optimized for each cell type) was used to quantify the number of double positive cells. At each time point the overlap/mm 2 count was subtracted from the red count/mm 2 to quantify the GFP − cell count. To calculate normalized CRISPR growth scores (CGS): For each gene the area under the curve was calculated as described in Figure 3A using the trapezoidal function of GFP − cell count vs time for the average from duplicate or triplicate wells. The area under the curve for the essential gene was subtracted from the area of the curve of the non-essential gene and for each gene of interest. The subtracted value for each gene of interest was then divided by the subtracted value for the non-essential gene such that the essential gene ran in parallel would receive a CGS of 0 and the non-essential gene would have a CGS of 1. CGS values were then combined across experimental replicates.

Flow Cytometry

For the Measurement of GFP and/or mCherry Loss after RNP Transfection 500–1000 mCherry + /GFP + cells were plated into 96 well plates and transfected as described above with gRNAs that target gGFP and/or gmCherry. 7–10 days after transfection, cells were trypsinized, pelleted by centrifugation, and resuspended in phenol-free medium. Flow cytometry was performed with a Gallios 561 (Beckman Coulter) using the 488 and 561 nM lasers for green and red fluorophore excitation, respectively. The appropriate side/forward scatter profile was used to exclude non-viable cells. The gates for GFP and mCherry positive cells were set based on unstained cells and Mcherry + /GFP + for each cell line.

Measurement of Proteasomal Flux by Flow Cytometry BT549

WT and ATG7−/− clones were made with stable expression of Ubiquitin (G76V) fused to the N-terminus of GFP ( Dantuma et al., 2000 ). Each stable cell line was plated in duplicate wells; one of which was left untreated and the other treated with bortezomib (50 nM) for 16–24 hours. The two conditions for each stable line were trypsinized, pelleted by centrifugation, and resuspended in phenol-red free medium. Flow cytometry analysis was performed with a Gallios 561 (Beckman Coulter) using 488nm laser for green excitation. The appropriate side/forward scatter profile was used to exclude non-viable cells. The gates for each stable line were set such that 5% of the untreated cells were counted as GFP − . Proteasomal flux was then calculated as the increase in viable cells that shifted into the 5% gate after treatment with bortezomib where each cell line was re-gated based on the corresponding untreated sample.

Measurement of Autophagic Flux by Ratiometric Flow Cytometry

BT549 cells stably expressing mCherry-GFP-LC3 were used for flow cytometric analysis. Cells were either left untreated, or washed twice with PBS before receiving EBSS for 24 hrs, or treated with bafilomycin A1 (10 nM) for 24 hrs. Flow cytometry was performed with a Gallios 561 (Beckman Coulter) using 488 and 561 nM lasers for green and red fluorophore excitation, respectively. The appropriate side/forward scatter profile was used to exclude non-viable cells. Autophagic delivery of the tandem constructs to the lysosome quenches the GFP signal, therefore cells undergoing autophagy were defined as those expressing a high mCherry/GFP fluorescence ratio. The gate to define cells undergoing autophagy was set based on cells treated with bafilomycin A1, a condition that represents cells with little or no autophagic flux. The bottom of the gate for each set of flow cytometry experiments was therefore set at the rightward base of the bafilomycin A1-treated curve (24 hr at 10 mM) such that 5% of bafilomycin A1-treated cells were included in the gate.

Measurement of ROS with cellROX

Cells were treated with cellROX green (1 mM) for 1 hr, then trypsinized and harvested for flow cytometry analysis with a Gallios 561 (Beckman Coulter) using the 488nM laser for green fluorophore excitation. Forward and side scatter was used eliminate non-viable cells. The cellROX+ gate was set such that 10% of the WT cells were gated as positive and the percent of cells for each of the clones was analyzed based on this gate. FACs Sorting Mcherry + /GFP + cells were subject to RNP transfections with gRNAs targeting GFP as well as a gene of interest as described above. 7–14 days later, the cells were trypsinized, pelleted by centrifugation, and resuspended in phenol-red free media. The appropriate side/forward scatter profile was used to exclude non-viable cells. The GFP − population was gated based on unstained cells (as shown in the figures), and sorted with a MoFlo XDP100 (Beckman Coulter). The sorted GFP- fraction was then plated and harvested 3–5 days later for western blot analysis of the GFP − pooled population.

Measurement of GSH Glutathione

(GSH) was measured in cell homogenates using a microtiter plate assay as previously described ( Vandeputte et al., 1994 ). Briefly, samples were collected by scraping cells from a 60 mm tissue culture dish into 10 mM HCl and homogenates prepared by sonication of sample. A 50-ml aliquot was collected for protein determination and 62.5 ml of 6.5% (w/v) sulfosalicylic acid added to precipitate protein in the remaining 250 ml sample. The sample was then incubated on ice for 10 mins followed by centrifugation at 2000 RCF and the resulting supernatant collected. Twenty microliters of blank, standard or unknown were added to a 96-well plate followed by 20 ml of 143 mM phosphate buffer (pH 7.4) and 200 ml of assay mix (143-mM phosphate buffer (pH 7.4), 6.3 mM EDTA, 1 mM 5,5’-dithios-2-nitrobenzoic acid (DTNB) and 0.34 mM NADPH. The plate was incubated for 5 minutes at room temperature followed by the addition of 40 ml of glutathione reductase (8.5 IU/ml in phosphate buffer). The reaction was monitored for the change in absorbance at 405 nm for 5 minutes and GSH concentrations were calculated from a standard curve using known concentrations of GSH (3.125 – 50 mM). Hypoxia Treatments 1,000 mCherry-NLS labeled cells were plated per well in 96 well plates. The following day the cells were switched to media buffered with HEPES (50 mM) and then placed in a humidified atmosphere at 37C, with 1% O 2 and 5% CO 2 . Every 24 hrs the plate was removed from the incubator to scan in the Incucyte and mCherry+ cell counts were calculated over time.

Western Blotting

Whole cell lysate samples were harvested in stringent-RIPA buffer, with 1X Protease inhibitor cocktail added fresh before each use. Nuclear lysates were harvested by the following nuclear extraction protocol: Washed and pelleted cells were resuspended in cell lysis buffer (10 nM HEPES (pH 7.5), 10 mM KCL, 0.1 mM EDTA, 1 mM dithiothreitol (DTT), 0.5% Nonidet-40, and 1X 4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride (AEDSF), 1X protease inhibitor cocktail), allowed to swell on ice for 15–20 minutes with intermittent mixing. Tubes were vortexed to disrupt cell membranes and centrifuged at 12,000g at 4C for 10 minutes. After the cytoplasmic extract was removed, the pellets were washed thrice in cell lysis buffer, and resuspended in nuclear extraction buffer (20mM HEPES (pH 7.5), 400mM NaCl, 1mM EDTA, 1mM DTT, 1X AEBSF, 1X protease inhibitor cocktail) and incubated on ice for 30 minutes. Nuclear extracts were collected by centrifugation at 12,000g for 15 minutes. A Bradford assay was used to calculate protein concentrations relative to a bovine serum albumin (BSA) standard curve. Western blotting was performed using standard methods including protein separation on SDS-PAGE 1.5mm mini gels in running buffer at 100V for 2hrs, followed by transfer to PVDF membranes in transfer buffer using a semi-dry transfer apparatus at 15V for 70 minutes. Membranes were blocked in 5% milk for 1hr at room temperature with gentle rocking, washed twice in 1X TBST, and then incubated overnight at 4C with gentle rocking in primary antibodies. Membranes were then washed thrice in TBST and incubated for 1hr at room temperature with gently rocking in secondary antibodies followed by 3 more TBST washes. Membranes were developed with Immobilon Western chemiluminescent HRP substrate (Millipore) and analyzed on the OdysseyFc imaging system. Antibodies are listed in the Key Resources Table . Clonogenic Growth Assay 2,000 H1650 cells were plated into 12 well plates. The following day cells were washed and treated with the indicated percent of Media/EBSS. After 72 hours, the media was replaced with full media for another 7 days, with media changes every 3 days. Cells were then washed fixed and stained with crystal violet. To quantify the signal, the crystal violet was solubilized and the absorbance read at 590 nm. qRT-PCR Reverse Transciptase Quantitative Polymerase Chain Reaction was performed on an Applied Biosystems ViiA 7 by Life Technologies machine with an epMotion 5070 Eppendorf robot as follows: the RNA was isolated using a Qiagen RNeasy mini kit following the manufacturer’s instructions. Next, a reverse transcriptase reaction was performed using the Qiagen Quantitect RT kit according to manufacturer’s instructions. The resulting cDNA was then subject to quantitative PCR using SYBR green CFX master mix from Applied Biosystems. A standard curve was used from 0.04 ng to 50ng of cDNA. The relative quantities of cDNA in each sample were calculated relative to this standard curve and normalized to 18s rRNA as housekeep gene control. Primers are listed in the Table S1 .

Protease Assays

The proteasome activity fluorometric assay kit II (UBPBio, catalog# J4120) was used to assess the chymotrypsin-like, trypsin-like, and caspase-like activities of the proteasome according to the manufacturer’s instructions. Cells were plated in 10 cm 2 dishes (850,000cells/plate) and harvested the next day in 1 ml of cold lysis buffer (40 mM Tris pH 7.2, 50 mM NaCl, 2 mM b-mercaptoethanol (bME), 2 mM ATP, 5 mM MgCl 2 , 10% glycerol). After sonication, the lysates were centrifuged and the protein concentrations assessed by a Bradford’s assay compared to a BSA standard curve. 25 mg of protein was added to a black 96 well plate (Costar catalog#3631) in 50 ml in replicates of 3 for each sample. 50 ml of one of the three substrates, Suc-LLVY-AMC (chymotrypsin-like), Boc-LRR-AMC (Trypsin-like), and Z-LLE-AMC (caspase-like) (diluted down to 100 mM in 1X assay buffer) was added to each lysate containing well. The plate was read on a Synergy HT (BioTek) plate reader with excitation/emission filter sets at 360/40 nm and 460/40 nm, respectively. Readings were taken ever 1:30 minutes for a total of 30 minutes. The fluorometric arbitrary units were graphed over time and linear regression analysis performed in PRISM to calculate the slope for each condition. Clustering Analysis Normalized RNA-seq data was downloaded as transcripts per million from the Cancer Cell Line Encyclopedia.

Cell lines with homozygous

ATG7 deletions were identified using cBioPortal ( Gao et al., 2013 ; Cerami et al., 2012 ). Expression was Z score normalized and selected to include only genes within two NRF2 gene signatures ( Goldstein et al., 2016 ; Namani et al., 2018 ). Hierarchical clustering was performed using Euclidean distance with complete linkage. A heatmap displaying gene expression was generated using the Complex Heat map R package (v1.20.0) (PMID: 27207943). ATG7 and NRF2 classification was compared using a Fisher’s exact test.

QUANTIFICATION AND STATISTICAL ANALYSIS

All graphs and statistical analysis was performed with PRISM software. The statistical details for each experiment can be found in the corresponding figure legend. One-way analyses of variance (ANOVA), two-way analyses of variance, or unpaired Student’s t-tests were performed where indicated in figure legends using Prism/Graphpad. *p < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

DATA AND CODE AVAILABILITY

The datasets generated during this study are available through the Cancer Cell Line Encyclopedia available at https://portals.broadinstitute.org/ccle/about.

LEAD CONTACT AND MATERIALS AVAILABILITY

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Andrew Thorburn ( andrew.thorburn@ucdenver.edu ). This study did not generate new unique reagents other than guide RNAs and all sequences are provided in Table S1 .

EXPERIMENTAL MODEL AND SUBJECT DETAILS Cell Lines All Cell lines were maintained at 37C and 5 % CO 2 . HCT116 (male) cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM) with 10 % fetal bovine serum (FBS). MCF7 (female) cells were maintained in Minimum Essential Media (MEM) with 10 % FBS and Insulin (0.01 mg/ml). BT549 (Female) cells were maintained in Roswell Park Memorial Institute medium (RPMI 1640) with 10 % FBS and Insulin (7.5 mg/ml). MDA-MB-468 (female) were maintained in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 with 10% FBS. NCIH292 (female), SJSA-1 (male), and NCIH1650 (male) cells were maintained in Roswell Park Memorial Institute medium (RPMI 1640) with 10 % FBS. MAF-794 were maintained in Optimem medium with 15% FBS. The HT1080 (male) cells were maintained in Minimum Essential Media (MEM) with Non-essential amino acids and sodium pyruvate. For experiments with galactose, RPMI 1640 media without glucose was supplemented with 10 mM galactose, 10% FBS, and 7.5 mg/ml insulin. NCIH-1650 cell lines with stable expression of ATG7 were made by transfecting PCDA3-EV or PCDNA3 containing human ATG7 isoform A, and then selected with hygromycin. All cell lines were maintained in penicillin streptomycin while in culture and periodically monitored for mycoplasma contamination. All cell lines were fingerprinted by short-tandem repeat profiling to confirm identity. Animal Studies All animal studies were performed in accordance with and approval by the Institutional Animal Care and Use Committee at Colorado State University. 6–8 week old female athymic nude (nu/nu) mice were purchased from The Jackson Laboratory, and housed in microisolator cages in the laboratory animal facility at Colorado State University. 2 × 10 6 H292 wild-type, or Atg7 −/− cells were injected subcutaneously into the right dorsal flank of mice in 100 mL of serum free RPMI media. Tumor volume was measured daily in a blinded fashion with digital calipers using the formula short diameter 2 × long diameter × 0.5. Once tumors reached 150 mm 3 , mice were randomized to vehicle control (0.9% saline) or hydroxychloroquine (HCQ) treatment groups, and treatment with 60 mg/kg HCQ, i.p. daily in 100 mL injection volume of 0.9% saline was initiated. Mice were weighed every other day for drug dosage calculations and sacrificed after 10% weight loss, or when tumor volume reached 1500 mm 3 .

METHOD DETAILS CRISPR with RNPs Each guide RNA (gRNA) was created by first running a nested PCR to generate a PCR template that contains the T7 sequence adjacent to a 20 base pair gRNA target sequence (designed using crispr.mit.edu ) and a tracer RNA region according to previous reports ( Liang et al., 2015 ). Specifically, an initial PCR reaction was used to amplify the tracer RNA from 20 ng of lentiCRISPRV2 plasmid using GTTTTAGAGCTAGAAATAGCAAG and AAAAGCACCGACTCGGTGCCAC oligonucleotides at 0.5 mM each and 0.5 ml of Phusion High Fidelity DNA Polymerase in a 50-ml reaction. Thermal cycles programed for 2 minutes at 98C for initial denaturation, followed by 35 cycles of 30 seconds at 98C for denaturation, 30 seconds at 55C as annealing, and 30 seconds at 72C for elongation and a final extension of 5 minutes at 72C. PCR products were examined by electrophoresis at 100–120 Volz for approximately 30 minutes in a 1% (w/v) agarose gel in 1x TAE buffer and the size was confirmed with a 1 KB DNA ladder. PCR products were purified with the Wizard SV Gel PCR clean up kit and eluted in 30 ml of RNAse/DNase free H 2 O. Subsequent nested PCRs were then amplified off of 17 ng of this product using a T7 FWD primer (TAATACGACTCACTATAG) and TrcRNA REV primer (AAAAGCACCGA CTCGGTGCCAC) each at 0.5 mM along with a Forward and Reverse primer corresponding to each specific gRNA sequence at 1.5 nM (see Oligos in Table S2 ) in a 50-ml reaction with 0.5 ml of Phusion High Fidelity DNA Polymerase. Thermal cycles programed for 2 minutes at 98C for initial denaturation, followed by 35 cycles of 30 seconds at 98C for denaturation, 30 seconds at 55C as annealing, and 30 seconds at 72C for elongation and a final extension of 5 minutes at 72C. PCR products were examined by electrophoresis at 100–120 Volz for approximately 30 minutes in a 1% (w/v) agarose gel in 1x TAE buffer and the size was confirmed with a 1 KB DNA ladder. PCR products were cleaned up with the Wizard SV Gel PCR clean up kit and eluted in 30 ml of RNase/DNase free H 2 O. 500 ng of each guide RNA template was then subject to In-vitro transcription with a MEGAshortscript T7 transcription kit according to manufactures instructions and incubated for 4 hrs at 36.5C followed by a 15-minute incubation with DNase treatment at 36.5C. The transcribed RNA was cleaned up with the MEGAclear transcription clean-up kit and eluted in 100 ml of elution buffer warmed to 98C. RNA concentration and purity was calculated with a nanodrop machine. RNA was then diluted to 10 ng/ml in RNase/DNase free H 2 O in single use aliquots and frozen at −80C. Five individual gRNAs were transcribed per gene and then tested for editing ability via an in-vitro Cas9 assay. Specifically, the region of DNA (300–600 base pairs) predicted to be cut was amplified from expression plasmids or cDNA via a standard PCR reaction. 60 ng of target PCRs were then incubated for 1 hr at 37 with bovine serum albumin (BSA), NEB Buffer #3, 100 ng of a single guide RNA and 150 ng of recombinant Cas9 protein from PNAbio. PCR products with and without Cas9 were examined by electrophoresis at 100–120 Volts for approximately 30–60 minutes in a 1% (w/v) agarose gel in 1x TAE buffer and the size was confirmed with a 1 KB DNA ladder. Based on their ability to edit in vitro and predicted off target binding 2 guide RNAs were chosen per gene to transfect into cells. Specifically, 200 ng of recombinant Cas9 (PNAbio) was incubated for 10 minutes with 5 ng of each guide RNA (two that target GFP and two that target the gene of interest). 7.4 ml of Opti-MEM reduced serum medium was then added to the eppendorf tubes along with 0.4 ml of Cas9 Plus Reagent (from the Lipofectamine CRISPR Max kit transfection kit) and allowed to incubate for another 10 minutes at room temperature. Simultaneously in separate eppendorf tubes 9.7 ml of Opti-MEM was incubated with 0.3 ml of CRISPRMAX reagent for 10 minutes at room temperature. The Cas9 plus incubation was then added to the CRISPRMAX incubation and allowed to incubate together for 15 minutes at room temperature. 20 ml of the transfection was added to each individual well of a 96 well plate where cells (mCherry + /GFP + ) were seeded at 500–1000 cells per well in 100 ml in triplicate wells the previous day and allowed to incubate for 4.5 hours at 37C and 5% CO 2 . The media was then dumped off and 200 ml of full medium was added back to each well, and plates were monitored by Incucyte live cell imaging for 7–10 days with images taken every 2–4 hours. Medium was replaced as needed every 3–4 days. For each cell line gRNAs targeting essential and non-essential genes were tested in parallel in triplicate wells on each 96 well plate and used for normalization. Oligonucleotoides used to design guide RNAs are located in Table S2 .

Incucyte Live Cell Imaging

Live cell imaging was performed with an Incucyte (dual color model 4459) at 4X magnification and images in the red and green channel were taken every 2–4 hours (for figure presentation, quantification ever 8–12 hours is shown). For mCherry cell count, mCherry + cells/mm 2 were masked (and optimized for each cell type). For caspase 3/7 activity: CellEvent Caspase 3/7 green reagent was added (2 mM) at the same time as drug and green events were masked (and optimized for each cell type). Green count/mm 2 was then normalized to red count/mm 2 to normalize for cell number at every time point. For quantification of GFP − cell count during the Live-cell CRISPR assay: the overlap mask (optimized for each cell type) was used to quantify the number of double positive cells. At each time point the overlap/mm 2 count was subtracted from the red count/mm 2 to quantify the GFP − cell count. To calculate normalized CRISPR growth scores (CGS): For each gene the area under the curve was calculated as described in Figure 3A using the trapezoidal function of GFP − cell count vs time for the average from duplicate or triplicate wells. The area under the curve for the essential gene was subtracted from the area of the curve of the non-essential gene and for each gene of interest. The subtracted value for each gene of interest was then divided by the subtracted value for the non-essential gene such that the essential gene ran in parallel would receive a CGS of 0 and the non-essential gene would have a CGS of 1. CGS values were then combined across experimental replicates.

Flow Cytometry

For the Measurement of GFP and/or mCherry Loss after RNP Transfection 500–1000 mCherry + /GFP + cells were plated into 96 well plates and transfected as described above with gRNAs that target gGFP and/or gmCherry. 7–10 days after transfection, cells were trypsinized, pelleted by centrifugation, and resuspended in phenol-free medium. Flow cytometry was performed with a Gallios 561 (Beckman Coulter) using the 488 and 561 nM lasers for green and red fluorophore excitation, respectively. The appropriate side/forward scatter profile was used to exclude non-viable cells. The gates for GFP and mCherry positive cells were set based on unstained cells and Mcherry + /GFP + for each cell line.

Measurement of Proteasomal Flux by Flow Cytometry BT549

WT and ATG7−/− clones were made with stable expression of Ubiquitin (G76V) fused to the N-terminus of GFP ( Dantuma et al., 2000 ). Each stable cell line was plated in duplicate wells; one of which was left untreated and the other treated with bortezomib (50 nM) for 16–24 hours. The two conditions for each stable line were trypsinized, pelleted by centrifugation, and resuspended in phenol-red free medium. Flow cytometry analysis was performed with a Gallios 561 (Beckman Coulter) using 488nm laser for green excitation. The appropriate side/forward scatter profile was used to exclude non-viable cells. The gates for each stable line were set such that 5% of the untreated cells were counted as GFP − . Proteasomal flux was then calculated as the increase in viable cells that shifted into the 5% gate after treatment with bortezomib where each cell line was re-gated based on the corresponding untreated sample.

Measurement of Autophagic Flux by Ratiometric Flow Cytometry

BT549 cells stably expressing mCherry-GFP-LC3 were used for flow cytometric analysis. Cells were either left untreated, or washed twice with PBS before receiving EBSS for 24 hrs, or treated with bafilomycin A1 (10 nM) for 24 hrs. Flow cytometry was performed with a Gallios 561 (Beckman Coulter) using 488 and 561 nM lasers for green and red fluorophore excitation, respectively. The appropriate side/forward scatter profile was used to exclude non-viable cells. Autophagic delivery of the tandem constructs to the lysosome quenches the GFP signal, therefore cells undergoing autophagy were defined as those expressing a high mCherry/GFP fluorescence ratio. The gate to define cells undergoing autophagy was set based on cells treated with bafilomycin A1, a condition that represents cells with little or no autophagic flux. The bottom of the gate for each set of flow cytometry experiments was therefore set at the rightward base of the bafilomycin A1-treated curve (24 hr at 10 mM) such that 5% of bafilomycin A1-treated cells were included in the gate.

Measurement of ROS with cellROX

Cells were treated with cellROX green (1 mM) for 1 hr, then trypsinized and harvested for flow cytometry analysis with a Gallios 561 (Beckman Coulter) using the 488nM laser for green fluorophore excitation. Forward and side scatter was used eliminate non-viable cells. The cellROX+ gate was set such that 10% of the WT cells were gated as positive and the percent of cells for each of the clones was analyzed based on this gate. FACs Sorting Mcherry + /GFP + cells were subject to RNP transfections with gRNAs targeting GFP as well as a gene of interest as described above. 7–14 days later, the cells were trypsinized, pelleted by centrifugation, and resuspended in phenol-red free media. The appropriate side/forward scatter profile was used to exclude non-viable cells. The GFP − population was gated based on unstained cells (as shown in the figures), and sorted with a MoFlo XDP100 (Beckman Coulter). The sorted GFP- fraction was then plated and harvested 3–5 days later for western blot analysis of the GFP − pooled population.

Measurement of GSH Glutathione

(GSH) was measured in cell homogenates using a microtiter plate assay as previously described ( Vandeputte et al., 1994 ). Briefly, samples were collected by scraping cells from a 60 mm tissue culture dish into 10 mM HCl and homogenates prepared by sonication of sample. A 50-ml aliquot was collected for protein determination and 62.5 ml of 6.5% (w/v) sulfosalicylic acid added to precipitate protein in the remaining 250 ml sample. The sample was then incubated on ice for 10 mins followed by centrifugation at 2000 RCF and the resulting supernatant collected. Twenty microliters of blank, standard or unknown were added to a 96-well plate followed by 20 ml of 143 mM phosphate buffer (pH 7.4) and 200 ml of assay mix (143-mM phosphate buffer (pH 7.4), 6.3 mM EDTA, 1 mM 5,5’-dithios-2-nitrobenzoic acid (DTNB) and 0.34 mM NADPH. The plate was incubated for 5 minutes at room temperature followed by the addition of 40 ml of glutathione reductase (8.5 IU/ml in phosphate buffer). The reaction was monitored for the change in absorbance at 405 nm for 5 minutes and GSH concentrations were calculated from a standard curve using known concentrations of GSH (3.125 – 50 mM). Hypoxia Treatments 1,000 mCherry-NLS labeled cells were plated per well in 96 well plates. The following day the cells were switched to media buffered with HEPES (50 mM) and then placed in a humidified atmosphere at 37C, with 1% O 2 and 5% CO 2 . Every 24 hrs the plate was removed from the incubator to scan in the Incucyte and mCherry+ cell counts were calculated over time.

Western Blotting

Whole cell lysate samples were harvested in stringent-RIPA buffer, with 1X Protease inhibitor cocktail added fresh before each use. Nuclear lysates were harvested by the following nuclear extraction protocol: Washed and pelleted cells were resuspended in cell lysis buffer (10 nM HEPES (pH 7.5), 10 mM KCL, 0.1 mM EDTA, 1 mM dithiothreitol (DTT), 0.5% Nonidet-40, and 1X 4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride (AEDSF), 1X protease inhibitor cocktail), allowed to swell on ice for 15–20 minutes with intermittent mixing. Tubes were vortexed to disrupt cell membranes and centrifuged at 12,000g at 4C for 10 minutes. After the cytoplasmic extract was removed, the pellets were washed thrice in cell lysis buffer, and resuspended in nuclear extraction buffer (20mM HEPES (pH 7.5), 400mM NaCl, 1mM EDTA, 1mM DTT, 1X AEBSF, 1X protease inhibitor cocktail) and incubated on ice for 30 minutes. Nuclear extracts were collected by centrifugation at 12,000g for 15 minutes. A Bradford assay was used to calculate protein concentrations relative to a bovine serum albumin (BSA) standard curve. Western blotting was performed using standard methods including protein separation on SDS-PAGE 1.5mm mini gels in running buffer at 100V for 2hrs, followed by transfer to PVDF membranes in transfer buffer using a semi-dry transfer apparatus at 15V for 70 minutes. Membranes were blocked in 5% milk for 1hr at room temperature with gentle rocking, washed twice in 1X TBST, and then incubated overnight at 4C with gentle rocking in primary antibodies. Membranes were then washed thrice in TBST and incubated for 1hr at room temperature with gently rocking in secondary antibodies followed by 3 more TBST washes. Membranes were developed with Immobilon Western chemiluminescent HRP substrate (Millipore) and analyzed on the OdysseyFc imaging system. Antibodies are listed in the Key Resources Table . Clonogenic Growth Assay 2,000 H1650 cells were plated into 12 well plates. The following day cells were washed and treated with the indicated percent of Media/EBSS. After 72 hours, the media was replaced with full media for another 7 days, with media changes every 3 days. Cells were then washed fixed and stained with crystal violet. To quantify the signal, the crystal violet was solubilized and the absorbance read at 590 nm. qRT-PCR Reverse Transciptase Quantitative Polymerase Chain Reaction was performed on an Applied Biosystems ViiA 7 by Life Technologies machine with an epMotion 5070 Eppendorf robot as follows: the RNA was isolated using a Qiagen RNeasy mini kit following the manufacturer’s instructions. Next, a reverse transcriptase reaction was performed using the Qiagen Quantitect RT kit according to manufacturer’s instructions. The resulting cDNA was then subject to quantitative PCR using SYBR green CFX master mix from Applied Biosystems. A standard curve was used from 0.04 ng to 50ng of cDNA. The relative quantities of cDNA in each sample were calculated relative to this standard curve and normalized to 18s rRNA as housekeep gene control. Primers are listed in the Table S1 .

Protease Assays

The proteasome activity fluorometric assay kit II (UBPBio, catalog# J4120) was used to assess the chymotrypsin-like, trypsin-like, and caspase-like activities of the proteasome according to the manufacturer’s instructions. Cells were plated in 10 cm 2 dishes (850,000cells/plate) and harvested the next day in 1 ml of cold lysis buffer (40 mM Tris pH 7.2, 50 mM NaCl, 2 mM b-mercaptoethanol (bME), 2 mM ATP, 5 mM MgCl 2 , 10% glycerol). After sonication, the lysates were centrifuged and the protein concentrations assessed by a Bradford’s assay compared to a BSA standard curve. 25 mg of protein was added to a black 96 well plate (Costar catalog#3631) in 50 ml in replicates of 3 for each sample. 50 ml of one of the three substrates, Suc-LLVY-AMC (chymotrypsin-like), Boc-LRR-AMC (Trypsin-like), and Z-LLE-AMC (caspase-like) (diluted down to 100 mM in 1X assay buffer) was added to each lysate containing well. The plate was read on a Synergy HT (BioTek) plate reader with excitation/emission filter sets at 360/40 nm and 460/40 nm, respectively. Readings were taken ever 1:30 minutes for a total of 30 minutes. The fluorometric arbitrary units were graphed over time and linear regression analysis performed in PRISM to calculate the slope for each condition. Clustering Analysis Normalized RNA-seq data was downloaded as transcripts per million from the Cancer Cell Line Encyclopedia.

Cell lines with homozygous

ATG7 deletions were identified using cBioPortal ( Gao et al., 2013 ; Cerami et al., 2012 ). Expression was Z score normalized and selected to include only genes within two NRF2 gene signatures ( Goldstein et al., 2016 ; Namani et al., 2018 ). Hierarchical clustering was performed using Euclidean distance with complete linkage. A heatmap displaying gene expression was generated using the Complex Heat map R package (v1.20.0) (PMID: 27207943). ATG7 and NRF2 classification was compared using a Fisher’s exact test.

Supplementary Material Supplemental figures and tables Supplemental video 4 Supplemental video 1 Supplemental video 3 Supplemental video 2 Supplemental video 5 Supplemental table 2 Supplemental table 1