CD4+CD25+ regulatory cells contribute to the regulation of colonic Th2 granulomatous pathology caused by schistosome infection.

Ethics statement

All experiments were carried out in accordance with UK Animal's Scientific Procedures Act 1986 and with the approval of The University of York Ethics Committee. Experimental infection and parasitological readout C57BL/6 (B.6) and hCD2-VaDsRed-B.6 mice were maintained within the University of York under specific pathogen-free conditions. hCD2-DsRed-B6 mice, were a gift of D. Kioussis and A. Patel (National Institute for Medical Research, London) and express fluorescent DSRed T cells (>90% CD3+) to facilitate in situ detection of T cells by multiphoton microscopy (see below). Eight to ten-week female mice were infected percutaneously via the abdomen with 25 S. mansoni cercariae, and infections allowed to mature for either 8 or 14 weeks representing the acute and chronic phases of infection respectively. Adoptive transfer recipients were infected with 100 cercariae. Egg burdens in the 5 cm of colon proximal to the cecum were enumerated following digestion in 4% KOH. Eggs in faecal material were enumerated following dispersion in PBS, filtration through 100 µm pore mesh, and concentration. Colonic granulomas were isolated as previously described [16] . Volumes were calculated by measuring the longest and widest points and extrapolating volume using standard formulae for sphere or cylinder, depending on individual granuloma shape.

Histology and confocal microscopy

C olonic tissue were fixed in 4% formaldehyde and embedded in wax. Transverse cross-sections (5 µm) were stained with H&E, or haemotoxylin and Van Geison (Department of Veterinary Pathology, University of Liverpool). Digital photomicrographs were analysed using AxioVision software (Zeiss). For multiphoton imaging, proximal colon segments were mounted within 10 mm depression slides, and granulomas imaged from the serosal surface to egg mid-point using a 510 NLO laser-scanning microscope (LSM, Zeiss) with multi-photon laser (Coherent) tuned to 872 nm. 3D projections of ‘half-granulomas’ were rendered from z stacks using Volocity 4 software (Improvision). Quantification of Ds-Red + lymphocytes, granuloma and collagen volumes were performed using “ROI” and “RGB” measurement tools within Volocity. For immunofluorescent staining, frozen tissues were cryosectioned at 8 µm intervals, fixed with 10% methanol, permeabilised with 0.5% saponin (Sigma), and blocked with 5% rabbit serum / 1% FCS. Sections were labelled with anti-CD4 AF488 and anti-FoxP3 AF647 (both eBioscience) and fluorescence captured using the 510 NLO LSM. Settings for acute and chronic fluorescence images are matched both with respect to laser scanning settings at the time of image capture and post-image digital enhancement. Baseline laser scanning settings were undertaken on isotype controls and resultant negative control images contain undetectable fluorescent signal.

Anti-CD25 mAb treatment

Three doses of anti-CD25 mAb (50 µg; clone PC61, a gift from F. Powrie, University of Oxford), or purified rat IgG2a, were delivered intraperitoneally to infected mice at 9, 11, and 13 weeks. T reg cell purification, adoptive transfer and in vitro culture T regs from the mLN were purified by depletion of non-CD4 + cells followed by isolation of CD25 + cells using antibodies conjugated to magnetic beads (Miltenyi Biotec). For adoptive transfer, 2.5×10 6 CD4 + CD25 + T regs (>90% purity) were injected via the lateral tail vein. Total mLN cells (2×10 6 /ml), sorted CD4 + CD25 − effector cells (1×10 6 /ml), and CD4 + CD25 + T regs (0.5×10 6 /ml) from infected mice cultured in complete RPMI-1640 medium (containing 10% FCS, 50 µg/ml penicillin/streptomycin), in combination with naïve mLN CD4 − CD25 − cells (0.1×10 6 /ml) as a source of APC. Cells were stimulated with plate-bound anti-CD3 mAb (1 µg; Becton Dickinson), or SEA (50 µg/ml) [16] . Cells were cultured for 72 h and supernatants retained for cytokine analysis. Proliferation was measured from 72 to 96 h by 3 H-thymidine incorporation and scintillation counting. Cytokine and collagen quantifications ELISAs were used to quantify IL-4, IL-5 and IFNγ [17] , while IL-10 and IL-13 were measured by Cytoset (Invitrogen) or DuoSet (R&D Systems) kits respectively. A TGFβ-sensitive, mink lung epithelial cell bio-assay (MLEC transfected with firefly luciferase; gift from Daniel Rifkin, NY Medical Center) was used to determine levels of bio-active TGFβ1 [18] . As the bio-assay was not compatible with tissue extracts, a TGFβ1 ELISA (R&D Systems) was employed. In order to determine cytokine levels in the colon, frozen tissues were first homogenised in proprietary tissue extraction buffer containing detergent and protease inhibitors (Thermo Scientific) and then incubated/rotated overnight at 4°C and the soluble fractions isolated by centrifugation prior analysis by ELISA. Salt-soluble collagen was quantified using colorimetric assay (Sircol, Biocolor).

Quantitative Real Time PCR

Total colonic mRNA was used to generate cDNA using Superscript III DNA polymerase (Invitrogen) and foxp3 transcript analysed by qRT-PCR (ABI PRISM 7000; Applied Biosystems) using Taqman probes (Sigma-Aldrich). The relative expression of foxp3 was normalised to values obtained for cd3 . Primer pairs and probes were; foxp3 5′-GCAGTGTGGACCGTAGATGA , 5′-CACAGCCTCAGTCTCATGGT , Probe 5′-ACAAGTGCTCCAATCCCTGCCCTT and cd3 5′-GAGCACCCTGCTACTCCTTG , 5′- ATGTCCCAGCACTGGCTACT , Probe 5′- TGCTCTTCAGCCTCCTGGTGAACAC .

Flow Cytometry

Cells were blocked with anti-CD16/CD32 (eBioscience) at 0.5 µg / 1×10 6 cells, then labelled with anti-CD4-Pacific Blue, anti-CD25-APC (PC-61), anti-CD103-PE (all eBioscience), anti-CD25-FITC (7D4), anti-CTLA-4-FITC, or anti-CCR5-biotin (BD Bioscience) for 30 minutes. Biotinylated antibodies were sequentially detected with streptavidin-PE-Cy7 (eBioscience). For intracellular staining of FoxP3, cells were fixed in 1% formalin, re-suspended in permeablisation buffer (Becton Dickinson) prior to labelling with anti-FoxP3-PE or -AF647 (eBioscience). Cells were analysed using a Cyan flow cytometer with Summit software (Beckman Coulter).

Statistical analyses

Significant differences between two experimental groups were determined by unpaired Student's T test, and between three or more groups by 1-way ANOVA with Tukey post-hoc tests using Prism software (GraphPad). Because colonic egg counts were skewed, analysis was undertaken after Log10 transformation. All data are representative of a minimum of two independent experiments. Significance is indicated *** P