Human β-Tubulin Isotypes Can Regulate Microtubule Protofilament Number and Stability.

Contact for Reagent and Resource Sharing

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Tarun M. Kapoor ( kapoor@rockefeller.edu )

Method Details Purification of recombinant human tubulin The codon optimized cDNA (Epoch Life Science Inc.) encoding Homo sapiens α-tubulin 1B ( NP_006073.2 ), β-tubulin 2B ( NM_178012.4 ) and β-tubulin 3 ( NP_006077.2 ) were cloned into pFastBac Dual vector (ThermoFisher 10712024). For affinity purification, a sequence encoding a Tobacco Etch Virus (TEV) protease site, a Gly-Gly-Ser-Gly-Gly linker and Strep-tag II were fused to the 3’ end of the β-tubulin cDNA sequence. In addition, sequence encoding a decahistidine tag, a Tobacco Etch Virus (TEV) protease site, and a Ala-Pro linker were fused to the 5’ end of the α-tubulin cDNA sequence. An L21 enhancer (AACTCCTAAAAAACCGCCACC, ( Sano et al., 2002 ) was added at the 5’ of the start codon (ATG). We used the Bac-to-Bac system (Life Technologies) to generate recombinant baculovirus. High Five cells (Life Technologies 10486–025), grown to 3.0–3.5 X 10 6 cells/ml in Express Five SFM (Life Technologies 10902–096) supplemented with 1X antibiotic-antimyocotic (Life Technologies 15240–062) and 18 mM L-glutamine (Life Technologies 25030–081), were infected with P3 viral stocks. Cells were cultured in suspension at 27 ºC and harvested at 60 hours after infection. The following steps were done on ice or at 4 ºC. Cells were lysed in an equal volume of lysis buffer (50 mM HEPES, 20 mM imidazole, 100 mM KCl, 1 mM MgCl 2 , 0.5 mM β-mercaptoethanol, 0.1 mM GTP, 3 U/ml benzonase, 1X Roche Complete EDTA-free protease inhibitor, pH 7.2) by dounce homogenization (20 strokes) and the homogenate was centrifuged at 55,000 rpm in a Type 70 Ti rotor (Beckman Coulter) for 1 hr. The supernatant was then filtered through a 0.22 μm Millex-GP PES membrane (Millipore SLGP033RS) and loaded onto two 1 ml HisTrap HP columns connected in tandem (GE life science 17–5247-01) pre-equilibrated with lysis buffer. The column was washed with 35 ml lysis buffer until the UV absorption reached baseline, then eluted with nickel elution buffer (1X BRB80 (80 mM PIPES, 1mM MgCl 2 , 1mM EGTA), 500 mM imidazole, 0.2 mM GTP, 2 mM β-mercaptoethanol, pH 7.2). The fractions containing proteins were pooled, diluted 3-fold with lysis buffer and loaded onto two 1 ml StrepTrap HP columns connected in tandem (GE life science 29–0486-53). The columns were washed with 25 ml 66% lysis buffer + 33% nickel elution buffer, 25 ml of wash buffer 1 (1X BRB80, 1 mM β-mercaptoethanol, 0.1 mM GTP, 0.1 % Tween-20, 10% glycerol, pH 7.2), and 25 ml of wash buffer 2 (1X BRB80 1 mM β-mercaptoethanol, 0.1 mM GTP, 10 mM MgCl 2 , 5 mM ATP, pH 7.2). The bound protein was then eluted with ~5 ml StrepTrap elution buffer (1XBRB80, 20 mM Imidazole, 2 mM β-mercaptoethanol, 0.2 mM GTP, 3 mM desthiobiotin, pH 7.2). The StrepTrap eluate was mixed with 4 mg of previously purified TEV protease (~8 mg/ml stored in 40 mM HEPES, 150 mM KCl, 30%(w/v) glycerol, 1 mM MgCl 2 , 3 mM β-mercaptoethanol, pH 7.5, and diluted into 5 ml StrepTrap elution buffer) and incubated for 2 hr on ice. The TEV-digested protein solution was loaded onto two 1 ml HiTrap SP Sepharose FF columns (GE life science 17–5054-01) followed, in tandem, by two 1 ml HisTrap HP columns, and washed with strep-elution buffer. The flow-through containing tubulin was pooled, concentrated with an Amicon Ultra 50K MWCO centrifugal filter unit (Millipore UFC901024), and loaded on to a Superdex 200 16/60 column (GE life science 17–1069-01) equilibrated in size-exclusion buffer (1XBRB80, 5%(w/v) glycerol, 0.2 mM GTP, 2 mM β-mercaptoethanol, pH 6.8). Tubulin eluted at ~80 ml and was concentrated to ~5 mg/ml with an Amicon Ultra 50K MWCO centrifugal filter unit. The purified tubulin was snap frozen in liquid nitrogen and stored at −80 ºC. Labeling recombinant human tubulin with X-rhodamine succinimidyl ester To label recombinant human tubulin with X-rhodamine succinimidyl ester, we polymerized microtubules using tubulin present in the flow-through of HiTrap SP/HisTrap columns as described above. The tubulin solution was concentrated to ~10 mg/ml with an Amicon Ultra 50K MWCO centrifugal filter unit, mixed with GMPCPP (final 1 mM), and incubated on ice for 5 min, and then polymerized by incubation at 37 °C for 45 mins. The polymerized microtubules were centrifuged through a high pH cushion (0.1 M Na-HEPES, 1 mM MgCl 2 , 1 mM EGTA, 60% glycerol, pH 8.6) at 90,000 rpm for 20 mins at 37 °C (TLA120.1 Beckman Coulter). At 37 °C, the microtubule pellet was rinsed with labeling buffer (0.1 M Na-HEPES, 1 mM MgCl 2 , 1 mM EGTA, 40% glycerol, pH 8.6) and suspended in 400 μl labeling buffer supplemented with 0.1 mM GMPCPP. A 20-fold molar excess of X-rhodamine succinimidyl ester (Fisher Scientific C6125, dissolved in DMSO) was added and incubated with microtubules at 37 °C for 45 mins, and then quenched with 400 μl quench buffer (2X BRB80, 100 mM K-glutamate, 40% glycerol). The labeled microtubules was centrifuged through a low pH cushion (1X BRB80, 60% glycerol) at 90,000 rpm for 20 mins at 37 °C (TLA120.2 Beckman Coulter). The microtubule pellet was rinsed with 1X BRB80 at 37 °C, suspended in 200 μl cold (4 °C) 1X IB buffer (50 mM K-glutamate, 0.5 mM MgCl 2 , pH 7.0), and dounce homogenized on ice every 5 mins for 60 mins, and then centrifuged at 90,000 rpm for 10 mins at 4 °C (TLA120.1 Beckman Coulter). The depolymerized tubulin was supplemented with 5X BRB80 (final 1X), MgCl 2 (final 4 mM) and GMPCPP (final 1 mM), incubated on ice for 5 mins, then at 37 °C for 1 hr, and then centrifuged at 90,000 rpm for 10 mins at 37 °C (TLA120.1 Beckman Coulter). The microtubule pellet was rinsed with warm (37 °C) 1X BRB80, suspended in 100 μl 1X IB, and then depolymerized on ice for 45 mins. The labeled tubulin was further clarified by centrifugation at 90,000 rpm for 10 mins at 4 °C (TLA120.1 Beckman Coulter). The concentrations of tubulin and X-rhodamine were measured by the absorption at 280 nm and 585 nm using the following equations. X-rhodamine labeling of α1B/β2B-tubulin: ~90%; and α1B/β3-tubulin: ~50%. [Tub]={[A 280nm -(A 585nm *dye contribution at 280 nm)] x dilution factor}/ ε 280nm, tub X-Rh dye contribution at 280 nm is 0.2 ε 280nm, tub =115000 [X-Rh]=(A 585nm *dilution factor)/ ε 585nm, Rh ε 585nm, Rh =80000 Purification of MAPs We purified rigor kinesin-1 motor domain (K347 CLM), GFP-tagged MCAK and GFP-tagged chTOG according to published protocols ( Cooper et al., 2010 ; Miller et al., 2016 ; Rice et al., 1999 ). Microtubule preparation for cryo-EM We observed that the polymerization of GTP-bound α1B/β2B- or α1B/β3-tubulin was not efficient when we employed published protocols for bovine tubulin (i.e., glycerol or DMSO). Therefore, to polymerize GMPCPP-stabilized microtubules, we revised the published protocol ( Alushin et al., 2014 ). We first prepared α1B/β2B or α1B/β3 microtubule seeds. Tubulin were thawed, mixed with GMPCPP (final 1.5 mM), diluted to ~ 1.5 mg/ml with 1XBRB80+5% glycerol, centrifuged at 90,000 rpm for 10 min at 4 °C (TLA120.1 Beckman Coulter), and then polymerized by incubation at 37 °C for 30 mins. The microtubules were pelleted at 90,000 rpm for 10 min at 37 °C (TLA120.1 Beckman Coulter) and re-suspended in warm (37 °C) 1XBRB80 supplemented with 1 mM TCEP. Next, we used these microtubule seeds to polymerize GTP-bound α1B/β2B- or α1B/β3-tubulin. Another aliquot of recombinant tubulin was thawed, diluted to a final concentration ~3 mg/ml (1XBRB80, 33% glycerol, 1 mM GTP), and spun at 90,000 rpm for 10 min at 4 °C (TLA120.1 Beckman Coulter). After incubation at 37 °C for 2 mins, the supernatant was mixed with GMPCPP-seeds from the prior step and then incubated at 37 °C for 30 mins followed by centrifugation at 90,000 rpm for 10 min at 37 °C (TLA120.1 Beckman Coulter). The microtubule pellets were rinsed twice with 100 μl warm (37 °C) EM buffer (1X BRB80, 1 mM DTT, 0.1 mM ATP, 0.05% Nonidet P-40) before suspending in 30 μl cold EM buffer and then incubated on ice for 1 hr. After a centrifugation at 90,000 rpm for 10 min at 4 °C, the supernatant containing depolymerized GDP-tubulin (~2 mg/ml, measured by Bradford assay) was mixed with GMPCPP (final 2 mM) and then incubated on ice for 10 mins. After an incubation at 37 °C for 2 mins, the protein solution was mixed with 30 μl warm (37 °C) EM buffer followed by 37 °C incubation for another 1 hr. The polymerized GMPCPP-microtubules were pelleted by 90,000 rpm for 10 min at 37 °C (TLA120.1 Beckman Coulter) and suspended in warm (37 °C) EM buffer. For taxol-stabilized microtubules, α1B/β2B and α1B/β3 tubulin were thawed, mixed with GTP (final concentration 2 mM), diluted to ~ 1 mg/ml with 1XBRB80+5% glycerol, and centrifuged at 90,000 rpm for 10 min at 4 °C (TLA120.1 Beckman Coulter) to remove any aggregates from the freeze-thaw cycle. After incubation at 37 °C for 2 mins, the supernatant was mixed with 1 μM taxol (final 0.1 μM, 37 °C 10 mins), followed by mixing with 10 μM taxol (final 1 μM, 37 °C 10 mins), and then mixed with 100 μM taxol (final 10 μM, 37 °C 15 mins). The microtubules were pelleted at 90,000 rpm for 10 min at 37 °C (TLA120.1 Beckman Coulter) and re-suspended in warm (37 °C) EM buffer containing 15 μM taxol.

Cryo-EM microscopy grid preparation and imaging

Taxol- and GMPCPP-microtubules were diluted to ~0.25 mg/ml in EM buffer. Microtubules were applied to a glow discharged C-flat grid (Electron Microscopy Sciences, 71150) in the chamber of a Vitrobot (ThermoFisher, Mark IV) set to 25 °C and 100% relative humidity. Microtubules were allowed to adhere to the grid for 30 sec, and rigor kinesin-1 motor domain in EM buffer was then added to the grid. After another 30 sec incubation, the grid was then blotted for 4 s and plunged into ethane slush. Micrographs were collected on a Titan Krios electron microscope operated at 300kV (GMPCPP-microtubules) or a Titan Arctica electron microscope operated at 200kV (taxol-microtubules) both equipped with Gatan K2 direct electron detectors. Micrographs were collected in superresolution mode using SerialEM with a nominal magnification of 29,000× (Krios) or 28,000× (Arcitca), giving a final non-superresolution pixel size of 1 Å per pixel (Krios) or 1.4375 Å per pixel (Arctica). Fifty frames of 200 ms each were collected with a defocus range from 1 to 2.4 μm at a dose rate of 8 e - per pixel per sec.

Cryo-EM image analysis and data processing

Movie frames were gain-normalized using the “clip” function from the IMOD processing suite ( Mastronarde and Held, 2017 ), then aligned with Unblur ( Grant and Grigorieff, 2015 ) for CTF estimation and particle picking. Unless otherwise noted, 2D processing steps were carried out using Relion ( Scheres, 2012 ). Contrast transfer function (CTF) estimation was performed using CTFFIND4 ( Rohou and Grigorieff, 2015 ) on summed images which had not been dose-weighted. Overlapping microtubule segments were then picked with a 512 pixel window every 80 Å along the filament axis, resulting in approximately 1 layer of unique tubulin dimers per segment, and extracted with alignparts_lmbfgs from frames 2 to 50 using per-particle alignments and dose-weighting ( Rubinstein and Brubaker, 2015 ). Segments were then subjected to reference-free 2D classification, and those contributing to well-defined class averages were selected for further processing. Adapting a workflow which has previously been described for initial 3D classification ( Alushin et al., 2014 ; Zhang et al., 2015 ), alignment and reconstruction was performed utilizing functions from the EMAN2 / SPARX libraries ( Hohn et al., 2007 ; Tang et al., 2007 ), followed by final refinement and reconstruction of individual classes in FREALIGN ( Lyumkis et al., 2013 ). To generate references, a single protofilament was extracted from EMD-6352, and initial models of 11–3, 12–3, 13–3, 14–3, 14–4, 15–3, 15–4, 16–3 and 16–4 protofilament microtubules were generated using previously determined helical parameters ( Sui and Downing, 2010 ) and low-pass filtered to 35 Å resolution. A multi-reference Iterative Helical Real Space Reconstruction (IHRSR) procedure adapted to appropriately symmetrize microtubules featuring a seam was then performed as described ( Alushin et al., 2014 ), estimating helical parameters with the program hsearch_lorentz ( Egelman, 2007 ). Segments corresponding to 13–3 (for GMPCPP α1B/β3) and 14–3 microtubules (for GMPCPP α1B/β2B) were then selected for further processing. Reconstructions corresponding to these classes from the multi-reference refinement were low-pass filtered to 35 Å, and then used as initial models for independent half-dataset refinement beginning with a global parameter search to minimize noise bias in refinement ( Scheres and Chen, 2012 ), utilizing a recently described EMAN2/SPARX procedure ( Kim et al., 2016 ) here adapted to implement microtubule symmetrization. Final refinement and reconstruction was performed in FREALIGN v9.11 ( Lyumkis et al., 2013 ) without refinement of independent-half datasets but restricting information used for alignment to 6 Å resolution. High-resolution reconstructions generated with FREALIGN were symmetrized with a previously described procedure ( Alushin et al., 2014 ; Zhang et al., 2015 ). Width analysis of 2D Class Averages 1-D density projections were generated from 2D class averages made vertical after determining their in-plane orientations from the radon transforms of their power spectra ( Li et al., 2002 ) with a procedure implemented in the SPIDER processing suite ( Shaikh et al., 2008 ). The two largest peaks in these density profiles were identified with a python script using the SciPy function “scipy.signal.find_peaks_cwt”, which correspond to the microtubule boundaries. Histograms of microtubule segment widths were then plotted based on the distribution of the distances between these peaks weighted by class membership. All custom software used in cryo-EM structure determination and analysis is available at [ https://github.com/alushinlab/microtubules ]. Atomic model building, analysis, and visualization Initial atomic models were generated in Coot ( Emsley et al., 2010 ) by mutating residues of existing GMPCPP-bound tubulin models (PDB ID 3JAT) to match the human β2B and β3 sequence and fixing obvious regions of poor fit. For model refinement, nine copies of this model were then docked into segmented density from the final 13 protofilament maps and further refined using Phenix ( Adams et al., 2010 ). The models were validated using EMRinger and MolProbity ( Barad et al., 2015 ; Chen et al., 2010 ). UCSF Chimera was used to perform RMSD calculations and prepare molecular graphics illustrations ( Pettersen et al., 2004 ).

Microtubule preparation for fluorescence microscopy assay

GMPCPP- and taxol-microtubules for TIRF assays were polymerized as for cryo-EM with minor changes. First, instead of EM buffer, BRB80 supplemented with 1 mM TCEP was used. Second, to visualize and immobilize microtubules in TIRF assays, α1B/β2B or α1B/β3 tubulin was polymerized with ~3.5 mol% of X-rhodamine-labeled and ~3.5 mol% of biotin-labeled bovine brain tubulin. The bovine brain tubulin was purified and labeled with standard published protocols ( Gell et al., 2011 ; Hyman et al., 1991 ). X-rhodamine labeling is ~92%, and biotin labeling is ~95%.

Fluorescence Microscopy assays

Microscope setup, TIRF sample chambers, and assay conditions were similar to published protocols ( Ti et al., 2016 ). Assays were done in buffer containing 1XBRB80, 5% sucrose, 1 mM MgCl 2 , 0.25 mg/ml κ-casein and oxygen scanvenging mix (0.2 mg/ml glucose oxidase, 0.035 mg/ml catalase, 4.5 mg/ml glucose, 143 mM β-mercaptoethanol). 10 μM paclitaxel was added in the buffer for experiments using taxol-stabilized microtubules. 1 mM Mg-ATP was added in the buffer for MCAK experiments. Time-lapse images were acquired at a rate of 1 frame/1 min for passive depolymerization assays and at 1 frame/5 sec for MCAK- and chTOG-dependent depolymerization assays. All fluorescence microscopy experiments were carried out at room temperature.

Quantification and Statistical Analysis

Data presented in the text are expressed as the mean ± standard deviation. Statistical significance was determined using two-sample unequal variance t-test with two-tailed distribution. Replicates, number of quantified microtubules and statistical results are indicated in figure legends for the respective expreiments.