Modeling Rett Syndrome With Human Patient-Specific Forebrain Organoids.

Materials and Methods hiPSC Lines and Maintenance

We used four healthy-control hiPSCs lines and two hiPSCs lines derived from patients with RTT-associated mutations. The healthy-control hiPSC lines were F002.1A.13 [46, XX cell line derived from a health donor by TCLab (Tecnologias Celulares para Aplicação Médica, Unipessoal, Lda.)], reprogrammed using a standard protocol by Takahashi et al. (2007) ; Gibco ® iPSC6.2 (46, XY human Episomal cell line, from a healthy donor) and iPS-DF6-9-9T.B (46, XY cell line, reprogrammed from foreskin fibroblasts, collected from healthy donors, using defined factors, in the Laboratory of Dr. James Thomson, at University of Wisconsin, and provided by WiCell Bank). All the previous healthy hiPSCs-controls were purchased under MTAs. The RTT cell lines were EMC25i/WT-R/F7 (46, XX cell line, derived from a healthy donor); EMC24i/R2 (C6) [46, XX cell line of a RTT patient with mutation at MECP2 (R255X), a nonsense mutation on C to T transitions at hypermutable CpG sites within the gene] and EMC24i/R2 (C5) (the respective isogenic cell line). The last three cell lines were derived by reprogramming skin fibroblasts ensuring data protection issues. Human skin punch biopsy samples (3 mm) were collected using a standard technique. The protocol was established with the Paediatric Surgery Department at Centro Hospitalar de Lisboa Norte (CHLN) to collect skin samples during minor surgeries. Biopsy tissue was expanded at Instituto de Medicina Molecular, Lisboa. Hospital Sant Joan de Déu (HSJD) and CHLN Ethic Committees approved the study and written informed consent was obtained from patient’s legal guardians. Then, the reprogramming of fibroblasts was performed at the iPSC Facility, Erasmus Medical Center, Rotterdam, using engineered color-coded lentiviral vectors ( Varga et al., 2016 ). Moreover, a RTT male cell line was also used, Rett Male: Q83X (46, XY cell line, derived from fibroblasts of a RTT male patient with a mutation at the amino acid residue 83 from glutamine to a premature stop codon, resulting in truncation and degradation of the MeCP2 protein). This cell line was donated by Alysson Muotri Lab at UCSD, United States, under an MTA. These cells were reprogrammed with retroviral reprogramming vectors (Sox2, Oct4, c-Myc, and Klf4) ( Takahashi and Yamanaka, 2006 ), and provided by University of California, San Diego Campus and approved by the institutional review boards at Salk Institute for Biological Studies and University of California, San Diego, as well as Pennsylvania State University ( Marchetto et al., 2010 ). All the hiPSCs lines were cultured on Matrigel TM (Corning)-coated plates with either Essential 8 TM Medium (Thermofisher Scientific) or mTeSR TM 1 Plus Medium (StemCell Technologies). Medium was changed according to the respective procedures. Cells were passaged every 3–4 days (at approximately 85% of cell confluence) using 0.5 mM EDTA dissociation buffer (Thermofisher Scientific). Before starting the differentiation process, two to three passages were performed. 3D Induction of Dorsal and Ventral Forebrain Organoids Before starting the ventral and dorsal neural induction protocols, the hiPSC were incubated with ROCK inhibitor (ROCKi, Y-27632, 10 μM, StemCell Technologies) for 30 min at 37°C and then treated with accutase (Sigma) for 5 min at 37°C. After dissociation, cells were seeded on microwell plates (AggreWell TM 800, StemCell Technologies) according to the manufacturer’s instructions. The cell density used was 1.5 × 10 6 cells/well in 1.5 mL/well of E8 TM or mTeSR TM 1 Plus supplemented with 10 μM ROCKi. The entire expansion medium was changed after 24 h, without ROCKi supplementation. Usually after 2–3 days, when the aggregates attained a diameter of 250–300 μm, the medium was half-changed to induction medium, and this day was defined as day 0. The neural induction medium used was N2B27, composed by 50% of DMEM/F12/N2 (DMEM-F12, (Thermofisher Scientific) supplemented with 1% (v/v) N2 (Thermofisher Scientific), 1.6 g/L Glucose (Sigma), 1% (v/v) PenStrep, and 20 μg/mL Insulin (Sigma) and 50% of Neurobasal/B27 [Neurobasal medium (Thermofisher Scientific) supplemented with 2% (v/v) B27(-Vitamin A)-supplement (Thermofisher Scientific), 2 mM L -glutamine (Thermofisher Scientific) and 1% (v/v) PenStrep]. For the dorsal forebrain patterning, the previously described medium was supplemented with 2 μM Dorsomorphine (Sigma) and 2 μM A83-01 (Tocris) until day 5, with half-medium changed at days 0, 3 and 5. For the ventral patterned aggregates, the medium was supplemented with 10 μM SB-431542 (SB) (Sigma) and 100 nM LDN-193189 (LDN) (Stemgent). At day 5, cell aggregates (around 300 aggregates per each well of the microwell plate used) were collected from the microwell plates and seeded in an Ultra-Low attachment 6-well plate (Corning). At day 7, half of the medium was changed for both dorsal and ventral patterning. In dorsal patterning cultures, the medium was supplemented with 1 μM CHIR99021 (Stemgent), 10 μM SB-431542 (Sigma) and 10 μg/ml Heparin (Sigma) and ventral patterning culture medium was supplemented with 2.5 μM IWP2 (Stemgent), 100 nM SAG (Millipore) and 10 μg/ml Heparin (Sigma). When required, on day 13, the assembly of one dorsal with one ventral organoid was performed inside a 96-TC Plate, Suspension, C (Sarstedt) and after 24 h the fused organoid was transferred into an Ultra-Low attachment 24-well plate. Maintenance and Maturation of Dorsal, Ventral and Fused Organoids On day 13, the medium was half-changed to N2B27 (+Vitamin A) without any small molecule supplementation and was maintained in the presence of this medium until day 41. This medium was replaced every 2/3 days. On day 41 of differentiation, the organoids were cultured in BrainPhys TM Neuronal Medium (StemCell Technologies), supplemented with NeuroCult TM SM1 Neuronal Supplement (StemCell Technologies), N2 Supplement-A (StemCell Technologies), Recombinant Human Brain Derived Neurotrophic Factor (BDNF, PeproTech, 20 ng/mL), Recombinant Human Glial-Derived Neurotrophic Factor (GDNF, PeproTech, 20 ng/mL), dibutyryl cAMP (1 mM, Sigma), and ascorbic acid (200 nM, Sigma). One third of the total volume was replaced every 2–3 days.

Tissue Preparation and Immunostaining

Organoids replated in coverslips were fixed in 4% (w/v) PFA (Sigma) for 20 min at 4°C, followed by washing in phosphate buffered saline (PBS, 0.1M). Whole 3D organoids were fixed in 4% PFA for 30 min at 4°C, with agitation, followed by washing in PBS 0.1M and overnight incubation in 15% (w/v) sucrose at 4°C. Then, they were embedded in 7.5% gelatin/15% sucrose and isopenthane (Sigma) was subsequently used for freezing at −80°C. A cryostat-microtome (Leica CM3050S, Leica Microsystems) was used to prepare organoid sections with approximately 12 μm thickness and collected on Superfrost TM Microscope Slides (Thermo Scientific) (stored at −20°C). Organoid sections were de-gelatinized in PBS at 37°C for 45 min and then analyzed by immunohistochemistry. Organoid sections and cells plated on coverslips were then incubated in 0.1 M Glycine (Millipore) for 10 min at room temperature (RT), permeabilized with 0.1% Triton X-100 (Sigma) for 10 min at RT, and blocked with 10% fetal bovine serum (FBS, Thermofisher Scientific) in TBST [20 mM Tris-HCl pH 8.0, 150 mM NaCl, 0.05% (v/v) Tween-20, Sigma] for 1 h at RT. Then, primary antibodies were diluted in blocking solution and incubated overnight at 4°C. After three washing steps with TBST, secondary antibodies were incubated for 45 min at RT. For phalloidin staining, cells were incubated with Alexa Fluor ® 488 Phalloidin during 30 min (1:50 in PBS, Thermofisher Scientific). For GFP staining, cryosections were incubated with anti-GFP polyclonal IgG, Alexa Fluor ® –488. Nuclear counterstaining was performed using 4′,6-diamidino-2-phenylindole (DAPI, 1.5 μg/mL; Sigma). After drying, sections and coverslips were mounted in Mowiol (Sigma). Fluorescence images were acquired using Zeiss LSM 710 Confocal Laser Point-Scanning Microscopes and images were processed in ZEN 2.3 blue edition software (Zeiss).

Flow Cytometry

Samples were collected with accutase (Sigma) for 5 min at 37°C and then stored in 2% w/v PFA (Sigma). Samples were centrifuged at 1000 rpm for 5 min and washed twice with PBS. Samples for KI67 analyzes were also collected with accutase, and then fixed drop by drop with 70% (v/v) ethanol (−20°C) with vortex. Samples were stored at −20°C, being then centrifuged at 1000 rpm for 10 min and washed twice with PBS. The Eppendorf tubes were coated with 1% v/v bovine serum albumin (BSA; Thermofisher Scientific) solution in PBS for 15 min. For intracellular staining, cell were resuspended in 3% (v/v) normal goat serum (NGS, Sigma), at approximately 1 × 10 6 cells per condition. The cell suspension was centrifuged again at 1000 rpm for 3 min. The cell membrane was then permeabilized using a solution 1:1 of 3% (v/v) NGS and 1% (v/v) saponin (Sigma) for 15 min, at RT. After washing three times with 1% (v/v) NGS, cells were resuspended in primary antibody solution (in 3% NGS) and incubated for 1 h at room temperature. Cells were then washed three times with 1% NGS, and incubated for 30 min in the dark with the secondary antibody (in 3% NGS) and 300 μL were transferred to a FACS (flow cytometry) tube. For surface staining, cells were resuspended in primary antibody diluted in 10% (v/v) FBS in PBS, at approximately 0.5 × 10 6 cells per condition, and incubated for 30 min at RT. Finally, cells were washed with PBS and resuspended in 10% (v/v) FBS in PBS and incubated with secondary antibodies for 15 min, at room temperature. After another washing step, cells were resuspended in PBS and 300 μL were transferred to a flow cytometry tube. Flow cytometry was performed using a FACSCalibur TM flow cytometer (by Becton Dickinson) and the data acquisition was performed with the Cell Quest software (Becton Dickinson). A minimum of 10,000 events were analyzed for each sample. The data analysis was performed using Flowing Software 2.0. As negative controls, unstained samples and samples stained with only the secondary antibody were used, without showing relevant differences between them. The gate was selected to contain less than 1% of false positives (i.e., 1% of the negative control samples). Primary antibodies used for flow cytometry were SSEA-4-PE (Miltenyi Biotec, 1:10) for surface staining and OCT4 (Invitrogen, 1:300) and KI67 (BD, 1:100) for intracellular staining. Secondary antibodies used were goat anti-mouse IgG Alexa Fluor – 488 (Invitrogen, 1:300) and anti-mouse IgG-PE (1:300, Miltenyi Biotec). Quantitative Real Time (qRT)-PCR At different time points of differentiation, RNA samples were extracted by using High Pure RNA Isolation Kit (Roche) and converted into complementary cDNA with Transcriptor High Fidelity cDNA Synthesis Kit (Roche). Real-time quantitative PCR (qPCR) was performed using the StepOne TM or the ViiA TM 7 RT-PCR Systems (Applied BioSystems). Taqman ® Gene Expression Assays (20X, Applied Biosystems) were selected for NANOG , PAX6 , TBR1, DLX2, NKX2.1, LHX6, FOXG1 and GAPDH . DLL1 , HES5 , PARVALBUMIN (PV ), VGLUT1 and GAPDH analysis were performed using the SYBR Green Master Mix (Nzytech). The results were analyzed with the StepOne TM or the QuantStudio TM RT-PCR Software. All PCR reactions were done in duplicate or triplicate and then normalized to the housekeeping gene GAPDH . The fold change was calculated using the 2 Δ Ct method and in some graphical results it was calculated relatively to the control condition levels obtained. The representative heatmaps were generated using the web tool Clustvis ( Metsalu and Vilo, 2015 ).

RNA in situ Hybridization

The probes were generated by using a template cDNA, amplified by PCR, with the reverse primers containing the T7 site: DLL1- fw (TGTGCCTCAAGCACTACCAG) rv(+T7) (TA ATACGACTCACTATAGGGATGCTGCTCATCACATCCAG); HES5 -fw (ACGCAGATGAAGCTGCTGTA) rv(+T7) (TA ATACGACTCACTATAGGGGGCCCTGAAGAAAGTCCTCT). The PCR products were gel-purified using the NZYGelpure kit (NZYTech) and used for reverse transcription with T7 polymerase (Agilent Technologies), DIG-dNTPs (Sigma), and RNase inhibitor. The RNA was precipitated with EtOH and NaOAC 3 at 20°C overnight, centrifuged 30 min at 13.000 g , and then washed with 70% EtOH, dried, and resuspended in nuclease-free H 2 O with 10mM of EDTA (stored at 20°C until use). The organoids were fixed in 4% PFA (w/v) during 1 h at 4°C. Fresh cryosections (12 μm) were incubated with 10 nM FISH probes, overnight, at 65°C in hybridization buffer, containing 1x salts, 10% dextran sulfate, 1 mg/mL rRNA, 1x Denhardt’s and 50% of deionized formamide (Sigma). After hybridization, the cells were washed twice, for 30 min at 65°C, using a washing buffer [10% formamide (Sigma) in 2 × SSC] and then washed at RT with TBST. The slices were then blocked using TBST with 2% (v/v) blocking reagent (Roche) and 20% (v/v) heat inactivated sheep serum (Sigma) for 1h at RT. The slices were then stained with antibody anti-DIG (Abcam) diluted into TBST, 2% (v/v) blocking reagent, 1% sheep serum and left to incubate overnight, at 4°C. After incubation, slices were washed four times with TBST. Afterward, organoid slices were incubated twice during 10 min in 0.4M NaCl, Tris 0.1M (pH8). The incubation was then performed with Fast-red tablets substrate (Sigma) diluted in 0.4M NaCl, Tris 0.1M (pH8) for 1–3 h in the dark until the visible spots appear, and then the reaction was stopped with PTW [PBS + 0.1% (v/v) Tween-20]. Immunofluorescence staining was then performed. Images were acquired using Zeiss LSM 710 Confocal Laser Point-Scanning Microscopes and processed in ZEN 2.3 blue edition software (Zeiss). Single Cell Calcium Imaging (SCCI) The organoids used in calcium imaging recordings were first dissociated gently with accutase, 4–5 days before the recordings, and replated into matrigel-coated 8-well chambers Lab-TekTM Chamber Slide (ThermoFisher Scientific). Before the experiments, cells were loaded with 5 μM Fura-2 AM (Invitrogen) in Krebs solution (132 mM NaCl, 4 mM KCl, 1.4 mM MgCl2, 2.5 mM CaCl 2 , 6 mM glucose, 10 mM HEPES, pH 7.4) for 45 min at 37°C in an incubator with 5% CO 2 and 95% atmospheric air ( Silva et al., 2020 ). Cells were washed in Krebs solution and then mounted on an inverted microscope with epifluorescence optics (Axiovert 135TV, Zeiss). Cells were continuously perfused with Krebs solution and stimulated by applying high-potassium Krebs solution (containing 50 mM KCl, isosmotic substitution with NaCl) or 100 μM histamine. The time course of SCCI experiments was the following: 300 s baseline, stimulation with KCl from 300 to 420 s, KCl washout from 420 to 600 s, stimulation with histamine from 600 to 720 s and histamine washout from 720 to 900 s recordings. Following that, Histamine/KCl ratios were calculated using the corresponding peak values given by normalized ratios of fluorescence at 340/380 nm from image pairs acquired every 200 ms by exciting the cells at 340 and 380 nm. Mature neurons typically depict ratios below 0.8 ( Agasse et al., 2008 ; Bernardino et al., 2013 ). Excitation wavelengths were changed through a high-speed switcher (Lambda DG4, Sutter Instrument, Novato, CA, United States). The emission fluorescence was recorded at 510 nm by a cooled CCD camera (Photometrics CoolSNAP fx). Images were processed and analyzed using the software MetaFluor (Universal Imaging, West Chester, PA, United States). Regions of interest were defined randomly and manually over the cell profile.

Patch-Clamp Recordings

Organoids were first dissociated gently with accutase, 4–5 days before the recordings, and replated into glass cover-slips previously coated with matrigel. Whole-cell patch-clamp recordings were visualized with an upright microscope (Zeiss Axioskop 2FS) equipped with differential interference contrast optics using a Zeiss AxioCam MRm camera and a x40 IR-Achroplan objective. During recordings, cells were continuously superfused with artificial cerebrospinal fluid (aCSF) containing 124 mM NaCl, 3 mM KCl, 1.2 mM NaH2PO 4 , 25 mM NaHCO 3 , 2 mM CaCl 2 , 1 mM MgSO 4 , and 10 mM glucose, which was continuously gassed with 95%O 2 /5%CO 2 . Recordings were performed at room temperature in current-clamp or voltage-clamp mode [holding potential (Vh) = −70 mV] with an Axopatch 200B (Axon Instruments) amplifier ( Dias et al., 2014 ). The step-and-hold stimulation protocol included 11 steps of 500 ms long depolarization pulses. The first injection current was −25 pA and the subsequent ones increased progressively until 225 pA. Action potential activity was recorded using patch pipettes (4–9 MΩ resistance) pulled from borosilicate glass capillaries (1.5 mm outer diameter, 0.86 mm inner diameter, Harvard Apparatus, Holliston, MA, United States) with a PC-10 Puller (Narishige Group, London, United Kingdom) filled with an internal solution containing 125 mM K -gluconate, 11 mM KCl, 0.1 mM CaCl2, 2 mM MgCl2, 1 mM EGTA, 10 mM HEPES, 2 mM MgATP, 0.3 mM NaGTP, and 10 mM phosphocreatine, pH 7.3, adjusted with 1 M NaOH, 280–290 mOsm. Acquired signals were filtered using an in-built, 2-kHz, three-pole Bessel filter, and data were digitized at 5 kHz under control of the pCLAMP 11 software programs (Molecular Devices, San José, CA, United States). The junction potential was not compensated for, and offset potentials were nulled before gigaseal formation. The resting membrane potential was measured immediately after establishing whole cell configuration and the junction potential of the electrode was considered (−12 mV). Firing patterns of neurons were determined in current-clamp mode immediately after achieving whole-cell configuration by a series of hyperpolarizing and depolarizing steps of current injection (1 s). In the voltage-clamp mode, spontaneous miniature postsynaptic currents were recorded in a CSF solution during 5 min. Analysis of the amplitude and half-peak within were performed off line using the Clampfit 11 software. AP velocity (dV/dt) in a train of AP firing near threshold was represented from the first derivate of the first AP generated. Lentiviral Transfection for Derivation of GFP + hiPSCs Lines HEK 293T cells were used for lentiviral production, followed by concentration by ultra-centrifugation. Briefly, a second generation packaging system composed of three plasmids (transfer vector with expression construct LV-GFP, the packaging plasmid psPAX2, and the envelope protein expression plasmid pMD2.G – pMD2.G, a gift from Didier Trono (Addgene plasmid # 12259 1 ; RRID: Addgene_12259 ), was mixed in a ratio of 2: 1 :1 in DMEM (Thermofisher Scientific) and Fugene6 transfection reagent (Roche) and 293T cells were transfected during 4 h to overnight. The supernatant from the transfected plate was collected every 24 h in serum-free conditions and concentrated by ultracentrifugation (Beckman XL-90) at 90.000 rpm for 2 h at 4°C. The concentrated viral solution was passed through a 0.45 μm low-protein binding filter and aliquots were used to transfect the hiPSCs lines. The cell lines F002.1A.13, Gibco ® iPSC6.2 and EMC24i/R2 (C6) were successfully transfected, by first incubating the cells in a 24-well plate during 30 min at 37°C with E8 medium, 10 μM ROCKi and 5 μg/mL of Polybreme (Sigma). Then, LV-GFP previously dissolved in E8 was added dropwise and the cells were incubated during 1 h30 min. Culture medium was then changed daily. After cell growth and expansion, FACS sorting of GFP + cells was performed using BD FACSAria TM III (BD Biosciences-US) in order to obtain pure populations.

Statistical Analysis

The data were expressed as mean of ± standard error of mean (SEM) from at least three independent n experimental replicates/differentiations, as n number of organoids analyzed or n neurons (SCCI and patch-clamp recordings). Mean differences between control cell lines and RTT lines were evaluated by two-tailed unpaired and non-parametric t -test. Statistical processing was performed using Microsoft Excel and GraphPad Prism Software. Statistical significance level was set for ( ∗ ) p -values < 0.05; ( ∗∗ ) p -values < 0.01; ( ∗∗∗ ) p -values < 0.001. The statistical details of experiments are also present in the figure legends.

Data Availability

The authors declare that all raw data presented in all the figures of the manuscripts that support the findings of this study are available from the corresponding author upon request.

Supplementary Material The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcell.2020.610427/full#supplementary-material Click here for additional data file.