Wnt signals organize synaptic prepattern and axon guidance through the zebrafish unplugged/MuSK receptor.

Whole-mount inmmunocytochemistry, wnt11r-FLAG in vivo staining Embryos were fixed and stained as described in ( Zeller et al., 2002 ). For labeling of AChRs, embryos were permeabilized in 1mg/ml collegenase (Sigma) in phosphate buffer for 6-8 minutes, rinsed in 1xPBS and incubated with AlexaFluor conjugated α-bungarotoxin (Molecular Probes, Eugene, OR) as described by ( Lefebvre et al., 2004 ). Antibodies and dilutions were used as follows: znp-1 (1:200, DSHB), SV2 (1:50, DSHB), myc (9E10, 1:1000, Covance), Prox1 (1:200), F59 (1:20, DSHB), and anti-chondriotin sulfate (CS56, 1:200, Sigma). Embryos were imaged with LSM510 (Zeiss) and LCS (Leica) confocal microscopes. Quantification of AChR clusters: Confocal images were projected into a single plane and converted to a 16-bit image using Metamorph. A region of interest was drawn around the border of each somitic segment. AChR clusters were counted using the ‘count nuclei’ function, with the minimum/maximum length set to 5/ 100 pixels, respectively and, a minimum average intensity of 60 above background. The results were exported to Microsoft Excel for statistical analysis. Wnt11r-FLAG was affinity purified from transfected HEK cells, and injected into live embryos as previously reported for αBTX ( Lefebvre et al., 2004 ) and detailed in the Supplemental Material section. Morpholino and mRNA injections 3-4 nanograms of wnt11r translation blocking MO ( wnt11r TL-MO) ( Matsui et al., 2005 ) were injected into one-cell embryos. A splice-blocking MO ( wnt11r SP-MO, 5’TTTTTCTCAGTAACTCACCTCGTTC3’) was designed against the splice donor site of exon 3. 6-7 nanograms of wnt11r SP-MO were injected into the embryos at one-cell stage. For RT-PCR analysis, cDNA templates were synthesized from five 24-hpf embryos. PCR Primers were: 5’-TCCTCACATTCCTGCTCCTGTC-3’ (forward) and 5’-TCTTCATCTTCATTGGGGCATC-3’ (reverse). mRNA was in vitro transcribed from linearized constructs using SP6 mMessage mMachine Kit (Ambion), and injected into embryos at the 1- to 2-cell stage. In vitro GST pull-down assay Wnt11r-FLAG conditioned medium from transfected 293T cells was incubated with GST proteins and GST-UnpSV1ECD fusion proteins expressed in E.coli and absorbed to Glutathione Sepharose 4B, and after washing eluted proteins were detected with anti-FLAG antibody (1:1000, Sigma) and anti-GST antibody (1:5000, Sigma) on Western Blots as detailed in the Supplemental Method section. Transient transfection, co-immunoprecipitation, and western blotting Transient transfection and immunoprecipitation were carried out as previously described ( Lu et al., 2004 ) with some modifications as detailed in the Supplemental Method section. Transgenes Transgenic lines were generated by microinjection of DNA as previously described ( Thermes et al., 2002 ). The lines generated in this studies are: Tg( hsp70l :unpSV1-myc)p1, Tg( hsp70l :unpFL-myc)p1, Tg( smyhc1 :unpSV1-myc)p1 and Tg( smyhc1 :unpFL-myc)p1 in accordance with ZFIN nomenclature. Heat-shock condition The embryos from the cross of unplugged tbr307/tbr307 ; hsp70l :SV1(FL)-myc/+ to unplugged tbr307/tbr307 were kept at 28°C to the desired stage before the heatshock. Each pair of embryos was then placed in 100 μl E3 medium in a single well of 96-well PCR plate. Embryos were heat-shocked at 38°C for 35 minutes at 2.5 hours intervals until they reached the appropriate stage. Transgenic embryos were identified from the control siblings by genotyping using the following primers: 5’TGACCAGATGCTCAAATCTGGTCTTTC3’ (forward) and 5’ATTAAGCTAGCGGTGAGGTCGCCCTA3’(reverse). Live imaging 16 to 20 somite embryos were mounted in MatTek glass bottom culture dishes using 1.2% NuSieve GTG agarose prepared in Ringers plus Tricane, and image stacks taken every 2 minutes using a Perkin Elmar UltraView spinning disk confocal equipped with a 63x lens. Growth cones were analyzed based on their morphologies during pathfinding. Plasmid construction Standard molecular biology methods were used to generate unplugged FL, SV1, wnt11r, Dsh plasmids for protein expression, yeast two hybrid and in situ hybridization as outlined in the Supplemental Methods section. In situ hybridization Fluorescent in situ hybridizations were performed according to ( Downes et al., 2002 ) and ( Schneider and Granato, 2006 ). Probes compelementary to 5’UTR sequence of UnpSV1 (nt 1-340) or UnpFL unique coding sequence (nt 664-1012) were used. For wnt11r , probes complementary to wnt11r full-length sequences were used.

Supplementary Material 01 02 03