Adrenomedullin Induces Cardiac Lymphangiogenesis After Myocardial Infarction and Regulates Cardiac Edema Via Connexin 43.

Methods and Results: Firstly, we identified sex-dependent differences in cardiac lymphatic numbers in uninjured mice using light sheet microscopy. Using a mouse model of Adm overexpression ( Adm hi/hi ) and permanent left anterior descending (LAD) ligation to induce MI, we investigated cardiac lymphatic structure, growth, and function in injured murine hearts. Overexpression of Adm increased lymphangiogenesis and cardiac function post-MI while suppressing cardiac edema and correlated with changes in Cx43 localization. Lymphatic function in response to AM treatment was attenuated in mice with a lymphatic-specific Cx43 deletion. In vitro experiments in cultured human lymphatic endothelial cells (hLECs) identified a novel mechanism to improve gap junction coupling by pharmaceutically targeting Cx43 with verapamil. Finally, we show that connexin protein expression in cardiac lymphatics is conserved between mouse and human.

METHODS

The authors declare that all supporting data are available within the article and its online supplementary files. Animals. Adm hi/hi mice were designed as previously described in which the targeting vector replaces the endogenous 3’ UTR to stabilize the mRNA and increase half-life thusly elevating Adm expression 33 . Genotyping was assessed using a standard PCR-based strategy with 3 primers: primer 1: 5′-AACCTTAC ACCTTGCTGAGACATTC-3′; primer 2: 5′-TTTATTAGGAAAGGACAGTGG GAGTG-3′; primer 3: 5′CCCACATT CGTGTCAAACGCTAC-3′. Primers 1 and 3 amplify a 760-bp wild-type allele, while primers 2 and 3 amplify a 600-bp targeted allele. Mice used in these studies were backcrossed to C57Bl6 for over nine generations. For all experiments, littermate animals or age-matched C57Bl6 wild type males were used as controls. All mice used were 3–6 months of age (n=84males; 33females). Cx43 (Gja1)- floxed ( Cx43 fl/fl ) mice 34 (JAX strain number 008039) were crossed with inducible Vegfr3-CreER (T2) mice 35 to produce Vegfr3-CreER T2 ; Cx43 fl/fl . Cre-mediated recombination was induced by administering TAM (Sigma-Aldrich T5648) dissolved in corn oil and ethanol to mice aged 1–5 months (n=28) for 5 consecutive days at a dose of 10 μg/g intraperitoneally. Wild-type and Cx43-floxed allele PCR was determined by protocol provided by the Jackson Laboratory. Genotyping the Vegfr3-CreER (T2) allele was assessed using a standard PCR-based strategy with 2 primers: primer 1: 5’ GGCTGGACCAATGTAAATATTG 3’ and primer 2: 5’ CATCATCGAAGCTTCACTG 3’ to amplify a 285-bp targeted allele. For all experiments, littermate animals or age-matched Vegfr3 +/+ ; Cx43 fl/fl or Vegfr3 +/+ ; Cx43 fl/+ were used as controls. The animal study was in line with the guidelines and approved by the Office of Animal Care and Use at the University of North Carolina - Chapel Hill and complied with National Institute of Health guidelines. MI model-permanent ligation of the left anterior descending (LAD) coronary artery. Mice were anesthetized using ketamine (100 mg/kg, im) and xylazine (15 mg/kg, im) and rectal temperature maintained at 37 ± 0.5ºC. The trachea was cannulated with a 20 mm length of 18-gauge polyethylene tubing, followed by ventilation with a positive-pressure, constant-volume ventilator (model 845; Harvard Apparatus Co., South Natick, MA; stroke volume 200 ul, 150 strokes/min). A 3 mm left thoracotomy was performed between the third and fourth ribs to visualize the left anterior descending coronary artery (LAD). The proximal trunk of the LAD was ligated with 7–0 silk suture. The muscle and skin incisions were closed with 6–0 and 5–0 suture, respectively, buprenorphine administered (40 ug/kg, sc) and the animal gradually weaned from the respirator. Light sheet microscopy. Adult murine hearts were fixed and stained using the iDISCO method as previously described using rabbit anti-LYVE1 (1:500, Fitzgerald) primary antibody for 8 days and incubated with secondary donkey anti rabbit AF647 (1:200, Thermo Fisher Scientific) for 8 days 36 . Samples were imaged using the Lavision Ultramicroscope II light-sheet system. Images were acquired with Imaris software. Echocardiography. Conscious echocardiography was performed using VSI 2100 high frequency ultrasound (VisualSonics) as previously described 37 . Infarct and fibrosis. Infarct size was assessed using traditional H&E histology and cardiac sections using a modified midline infarct size method as previously described 38 . Fibrotic area was measured by threshold level in Fiji and normalized to total area. Scrape-loading dye transfer. A confluent monolayer of hLECs was grown on coverslips. The scrape assay was performed as previously described 39 . Quantitative tail microlymphography. Anesthetized adult Vegfr3-CreER T2 ; Cx43 fl/fl and control animals were injected in the tail with 10μl of a 25% FITC-Dextran (2,000,000 kDa) with a vehicle or AM peptide [10ng/μL] as previously described 13 . The flow of FITC-Dextran through dermal tail lymphatics was acquired with Leica MZ16FA dissecting stereoscope outfitted with a QImaging Micropublisher 5.0 RTV color CCD camera for several minutes post injection using Metamorph software (Molecular Devices Corp.). Analyses were performed using Fiji. Edema formation assay. Anesthetized adult Adm hi/hi and control animals were injected with 10μl of [4μg/μl] of Complete Freund’s Adjuvant (CFA) as previously described in one hind paw while the other paw served as a control 40 . Paw thickness was measured using calipers before CFA injection and every day after injection for 6 days. Evans blue ear injection. Ear lymphatic permeability was assessed as previously described 40 . Anesthesized adult Vegfr3-CreER T2 ; Cx43 fl/fl and control animals were injected intradermally with 3μl 0.5% Evans Blue dye (Sigma-Aldrich) in saline with a 10μl Hamilton syringe fitted with a 30 gauge needle. Images of the ears were acquired with Leica MZ16FA dissecting stereoscope outfitted with a QImaging Micropublisher 5.0 RTV color CCD camera using Metamorph software (Molecular Devices Corp.) at 0min., 5min., and 15min. after injection.

Supplementary Material 313835 Online 313835 Preclinical Checklist