Arabidopsis acyl-CoA-binding proteins ACBP4 and ACBP5 are subcellularly localized to the cytosol and ACBP4 depletion affects membrane lipid composition.

Plant materials and growth conditions Onions ( Allium cepa L.) were obtained from a local supermarket for particle gun bombardment. Unless otherwise stated, Arabidopsis thaliana ecotype Columbia (Col-0) was grown under 16 h light (23 °C)/8 h dark (21 °C) cycles.

Western blot analysis

Protein extracts were prepared by homogenizing Arabidopsis tissues in ice-cold extraction buffer (0.1 M TES, pH 7.8, 0.2 M NaCl, 1 mM EDTA, 2% β-mercaptoethanol and 1 mM PMSF). Total proteins were separated on SDS-PAGE and transferred onto Hybond-C membranes (Amersham). The blots were blocked in TTBS (TBS plus 0.05% Tween 20) containing 5% nonfat milk for 2 h and incubated for an additional 2 h with anti-ACBP4 or anti-ACBP5 primary antibodies. The blots were washed three times with TTBS and then incubated with secondary antibody for 1 h. Either the Amplified Alkaline Phosphatase Goat Anti-rabbit Immuno-blot Assay Kit (BioRad) or the ECL Western Blotting Detection Kit (Amersham) was used following the manufacturer’s instructions to detect cross-reacting bands. To generate ACBP4- and ACBP5-specific antibodies, synthetic peptides (RMQTLQLRQELGEAE corresponding to amino acids 566 to 580 of ACBP4, and KEELAEIDTRNTE corresponding to amino acids 554 to 566 of ACBP5) were used for rabbit immunization. Subcellular fractionation of Arabidopsis proteins by differential centrifugation Subcellular fractionation of Arabidopsis proteins was carried out following the protocols as described ( Smith et al. 1988 ; Zhang et al. 2007 ) with minor modifications. Three-week-old wild-type (Col-0) Arabidopsis rosettes (2–3 g) were ground to fine powder in liquid nitrogen using a mortar with a pestle. The powder was transferred into 10 ml grinding buffer (0.3 M sucrose, 40 mM Tris-HCl (pH 7.8), 5 mM MgCl 2 , 1 mM PMSF) and swelled on ice for 5 min. Homogenization was performed for two 30-second pulses at high-speed setting. The homogenate was filtered through two layers of Miracloth (Tetko, Elmsford, N.Y., USA) and was subsequently separated by centrifugation at 350 g for 10 min at 4 °C. The pellet (crude nuclear) was further layered onto 1 ml of 2.3 M sucrose, 50 mM Tris-HCl (pH 8.8), 5 mM MgCl 2 in an Eppendorf tube for centrifugation at 15,000 g for 10 min at 4 °C, to obtain the nuclear fraction in the derived pellet. Supernatants from the first low-speed centrifugation (350 g ) were centrifuged at 12,000 g for 20 min at 4 °C. The pellet contained large particles including mitochondria, chloroplasts and peroxisomes. The supernatant was further centrifuged at 100,000 g for 1 h at 4 °C to yield the soluble cytosol fraction in the resulting supernatant. The pellet representing the membrane fraction was resuspended in 0.1 ml grinding buffer. Protein concentration in the extract was determined following the method of Bradford (1976) using the Bio-Rad Protein Assay Kit I.

Immuno-electron microscopy

Arabidopsis roots and leaves were fixed in a solution of 4% (v/v) paraformaldehyde and 0.5% (v/v) glutaradehyde in 0.1 M phosphate buffer (pH 7.2) for 20 min under vacuum and then a further 3 h at room temperature. The specimens were then dehydrated in a graded ethanol series, infiltrated in stepwise increments of LR white resin (London Resin, Theal, Berkshire, UK) and polymerized at 45 °C for 24 h. Materials for immuno-gold labeling were prepared according to the procedure of Varagona and Raikhel (1994) with modification as described. Specimens (90 nm) were sectioned using a Leica Reichert Ultracut S microtome and mounted on formvar-coated slotted grids. Grids were incubated in a blocking solution of TTBS containing 1% (w/v) fish skin gelatin and 1% (w/v) BSA for 30 min. Anti-ACBP4 and anti-ACBP5 antibodies diluted 1:50 in blocking solution were added and incubated at room temperature for 2 h. The grids were then rinsed three times, each for 5 min, in TTBS and then incubated for 2 h in 10 nm gold-conjugated goat anti-rabbit IgG secondary antibody (Sigma), diluted 1:20 with blocking solution. Grids were rinsed three times, each for 5 min in TTBS, following by three 5-min rinses in distilled water. After staining in 2% (w/v) uranyl acetate for 6 min followed by 2% (w/v) lead citrate for 6 min, the sections were visualized and photographed using Philips EM208s electron microscope operating at 80 kV. Control sections were prepared by replacing the primary antibody with blocking solution.

Construction of autofluorescence-tagged plasmids

All binary vectors used in this study were derived from plasmids pRGD, pGDG and pBI-eGFP which contain genes encoding the autofluorescent proteins DsRed2, GFP and eGFP, respectively ( Goodin et al. 2002 ; Leung et al. 2006 ; Shi et al. 2005 ). For the pACBP4∷DsRed construct, a 2-kbp Xho I- Bam HI fragment encoding the complete ACBP4 coding sequence was generated by PCR using plasmid pAT181 ( Leung et al. 2004 ) as template. For the pACBP5∷DsRed construct, a 1.9-kbp Xho I- Bam HI fragment encoding the complete ACBP5 coding sequence was generated by PCR using plasmid pAT182 ( Leung et al. 2004 ) as template. The primers used in PCR were as follows: for ACBP4, ML350 (5’-C CTCGAG AATGGCTATGCCTAGGGC-3’, Xho I site underlined) and ML682 (5’- GGATCC ACAAGGCGAATCATCATCT-3’, Bam HI site underlined) and for ACBP5, ML683 (5’- CTCGAG ATGGCTCACATGGTGAGAGCG −3’, Xho I site underlined) and ML684 (5’- GGATCC ACATGTTTTAGGCGGAGGAG −3’, Bam HI site underlined). The fragments were subsequently cloned in pGEM-T Easy vector to generate plasmids pAT280 and pAT281, respectively. The 2-kbp Xho I- Bam HI ACBP4 fragment derived from plasmid pAT280 was cloned into the Xho I and Bam HI sites of pRGD to produce pACBP4∷DsRed. The 1.9-kbp Xho I- Bam HI ACBP5 fragment derived from plasmid pAT281 was cloned into corresponding restriction endonuclease sites on pRGD to generate pACBP5∷DsRed. To generate the pGFP∷ACBP5 construct, the 1.9-kbp Xho I- Bam HI fragment released from pAT189 (a pBluescript II SK (−) derivative containing a 1.9-kbp ACBP5 full-length cDNA) was cloned into similar sites of pGDG. In the above plasmids, DsRed2 was fused to the C -terminus of ACBP4 or ACBP5, and GFP was fused to the N -terminus of ACBP5. The pGFP∷ACBP4 fusion was constructed by generating a 2-kbp ACBP4 cDNA fragment by PCR using primers ML849 (5’-AG CTCGAG ATGGCTATGCCTAGGGCAAC −3’, Xho I site underlined), and ML850 (5’- CG GAGCTC AATGGCATTACCGGACCAAA −3’, Sac I site underlined) and cloning into pGEM-T Easy vector to obtain plasmid pAT361. The Xho I- Sac I fragment from pAT361 was then inserted into the Xho I and Sac I sites of plant transformation vector pBI-eGFP. For the pACBP5∷GFP construct, a 1.9-kbp and Bgl II- Bam HI fragment derived from plasmid pAT282 was cloned into the Bam HI site of pBI-eGFP. The pACBP5∷Red plasmid was generated by insertion of a 2.6-kbp Bgl II- Bgl II fragment from plasmid pAT283 into the Bam HI site of plant transformation vector pSa13. Plasmid pSa13 is a pBI121 derivative obtained by a 0.5-kbp Sal I deletion of plasmid pSa7 ( Xu et al., 2004 ). Since the T-DNAs of plant transformation vectors, pGFP∷ACBP4, pACBP5∷GFP and pACBP5-Red harbor the kanamycin-resistant selectable marker, they were used for the generation of transgenic Arabidopsis plants. The cloning junctions in all constructs were confirmed by nucleotide sequence analysis before further use.

Transient expression in onion epidermal cells

Plasmids encoding autofluorescent protein fusions were introduced into onion epidermal cells by particle gun bombardment using a Biolistic PDS-1000/He system (BioRad). Gold particles (1.0 µm) were coated with the respective plasmid DNA and a helium pressure of 9.3 MPa was employed. About 360 µg of gold particles coated with 0.9 µg DNA was used in one shot. The target distance between the stop screen and onion piece was set at 9 cm. Following incubation in darkness at 22 °C for 15 h, the onion epidermal cells were examined under a Zeiss LSM 510 inverted confocal laser-scanning microscope Zeiss (Jena, Germany). Single optical sections were scanned as resulting images for each transient expression. Northern blot analysis Total RNA from plant tissues was isolated using TRIzol reagent (Invitrogen) following the manufacturer’s instructions. Thirty micrograms of total RNA were separated on a 1.5% agarose gel containing 6% formaldehyde and transferred to Hybond N membranes (Amersham). The following gene-specific primers were used to generate probes for RNA blot analysis: ACBP4 (ML350 and ML682) and ACBP5 (ML352, 5’-CGGATCCAATGGCTCACATGGTGAGAGCAG −3’ and ML353, 5’-CGAATTCTCATGGGCACTCATGTTTTAGGC −3’). The fragments were labeled with the PCR Digoxigenin Probe Synthesis Kit according to the manufacturer‧s instructions (Roche). Hybridization and detection were performed according to standard procedures as advised by the manufacturer (Roche). The blots were washed under conditions of high stringency (2 × SSC, 0.1% SDS for 2 × 15 min at room temperature; 0.5 × SSC, 0.1% for 2 × 15 min at 68 °C; 0.1 × SSC, 0.1% SDS for 2 × 15 min at 68 °C). Laser scanning confocal microscopy A Zeiss LSM 510 inverted confocal laser scanning microscope equipped with helium/neon lasers and multitracking was used for the analysis of GFP and DsRed localizations. GFP fluorescence was excited at 488 nm, filtered through a primary dichroic (UV/488/543), a secondary dichroic of 545 nm and subsequently through BP505-530 nm emission filters to the photomultiplier tube (PMT) detector. DsRed fluorescence was excited at 543 nm, the emission was passed through similar primary and secondary dichroic mirrors and finally through a BP560–615 nm emission filter to the PMT detector. The images were processed using the LSM 510 software (Zeiss, Jena, Germany).

Generation of transgenic plants expressing the autofluorescence-tagged fusions Transgenic

Arabidopsis plant lines expressing GFP∷ACBP4, ACBP5∷GFP and ACBP5∷Red fusions ( Fig. 3b ) were generated by Agrobacterium -mediated plant transformation ( Clough and Bent 1998 ). Following the initial screening of positive transformants on kanamycin-containing plant growth medium, they were confirmed by PCR analysis by using the CaMV 35S promoter specific primer 35SB (5’-CAATCCCACTATCCTTCGCAAGACC-3’) and gene-specific reverse primers ML850 (for GFP∷ACBP4) and ML852 (for ACBP5∷GFP and ACBP5∷Red).

Preparation of mesophyll protoplasts from transgenic Arabidopsis expressing

GFP∷ACBP4 and ACBP5∷GFP was performed according to Abel and Theologis (1994) .

Identification and complementation of an acbp4 mutant

The acbp4 T-DNA insertion mutant (SALK_040164) was screened from a T-DNA seed pool from SALK Institute Genomic Analysis Laboratory ( http://signal.salk.edu/ ). The T-DNA insertion in the gene was identified by PCR using T-DNA left border primer LBa1 (5’-TTTTTCGCCCTTTGACGTTGGA-3’), ACBP4 -specific forward primer ML412 (5’-CAGATCCTGTTGTAGAT-3’) and reverse primer ML418 (5’-TTGCCCGCCAAATATCA-3’). The PCR products were sequenced to confirm the T-DNA insertion site. Individual homozygous T-DNA mutant plants were identified by PCR. Amplification was initiated with denaturation at 95 °C for 3 min, followed by 30 cycles of 94 °C for 30 s, 55 °C for 30 s and 72 °C for 2 min, and another extension at 72 °C for 10 min. To check for ACBP4 mRNA expression in the acbp4 mutant, total RNA was isolated using TRIzol reagent (Invitrogen, Cat No. 15596-018) from leaves of 3-week-old wild-type and acbp4 mutant plants, followed by reverse transcription-PCR (RT-PCR) analysis using the Superscript™ First-strand synthesis system (Invitrogen, Cat No. 12371-019). Gene-specific primers used in RT-PCR were ML413 (5’-CAACAAGCTGCTGTCTATC-3’) and ML416 (5’-CCATGACAATTTCCCGTAC-3’). The ACTIN control was amplified using primers 5’-CACCGCTTAACCCGAA-3’ and 5’-GTGAGGTCACGACCAG-3‧. PCR amplification was initiated with denaturation at 95 °C for 3 min, followed by 28 cycles of 94 °C for 30 s, 55 °C for 30 s and 72 °C for 1 min, and an extension at 72 °C for 10 min. The complementation of the acbp4 mutant was carried out by Agrobacterium -mediated transformation ( Clough and Bent, 1998 ) using plant transformation vector pAT324, which was generated by insertion of a 2.0-kbp XhoI-Eco RI ACBP4 full-length cDNA fragment from pAT181 ( Leung et al. 2004 ) in binary vector pKMB ( Mylne and Botella 1998 ). The putative transformants (designated as cACBP4 ) were selected on MS medium containing Basta (57.8 µg/mlglufosinate). They were screened by PCR analysis using primer pairs 35SB/ML418, ML412/ML418 and LBa1/ML418 to identify putative cACBP4 transgenic plant lines.

Lipid analysis

Total lipids were extracted from 4-week-old seedlings of wild type, acbp4 mutant and two independent acbp4 -complemented transgenic lines ( cACBP4 #1 and #2) grown on MS medium containing 2% sucrose under continuous light according to the protocol provided by the Kansas Lipidomics Research Center ( www.K-state.edu/lipid/lipidomics ). Lipids were dried under nitrogen and polar lipids were analyzed on activated silica gel TLC plates (Merck, Germany) developed with chloroform/methanol/acetic acid/water (170/30/20/7, v/v/v/v) as a solvent system according to Branen et al. (2003) . Lipids were visualized by staining with α-naphthol spray reagent and were detected at 120 °C. For membrane lipid profiling, lipids were extracted as described above, from 5-week-old wild-type (Col-0) and acbp4 mutant Arabidopsis grown in a growth chamber under 16 h light, 23 °C/8 h dark, 21 °C. The solvent was evaporated under nitrogen after extraction and samples were sent by courier service for lipid profiling at the Kansas Lipidomics Research Center.

Plant materials and growth conditions Onions ( Allium cepa L.) were obtained from a local supermarket for particle gun bombardment. Unless otherwise stated, Arabidopsis thaliana ecotype Columbia (Col-0) was grown under 16 h light (23 °C)/8 h dark (21 °C) cycles.