Different characteristics and nucleotide binding properties of inosine monophosphate dehydrogenase (IMPDH) isoforms.

Reagents and Materials

Reagents were from Sigma–Aldrich (Castle Hill, NSW, Australia) unless otherwise stated. Tissue culture reagents and foetal bovine serum were from Invitrogen (Mount Waverley, VIC, Australia) and Bovogen Biologicals (Essendon, VIC, Australia) respectively. The anti-panIMPDH antibody was a kind gift from Frank Collart [52] , the anti-HA antibody was from Covance (Berkley, CA, USA), the anti-tubulin antibody from Abcam (Cambridge, UK), the anti-GFP antibody [53] and isoform-specific IMPDH antibodies [9] were generated as previously described. All secondary antibodies were from Molecular Probes (Eugene, OR, USA).

Generation of IMPDH constructs

To yield pmEGFP-C1 HA-IMPDH2-GFP, HA-IMPDH2 cDNA [35] was amplified by PCR with forward 5′-GGTGGTGCTAGCGCCACCATGTACCCATACGATGTGCCAGATTACGCT-3′ and reverse 5′- GGTGGCGACCGGTCCACCAGAACCACCTGCACCAGATGCACCTGTTCCGAAAAGCCGCTTCTCATACG-3′ primers, which was inserted into pmEGFP-C1 (Clontech, Mountain View, CA, USA) on NheI/AgeI sites. IMPDH chimeras and the truncated core domain constructs were cloned with an N-terminal HA-tag using a three-step PCR method (see Table S1 for primers) employed by Nimmesgern et al. , (1999) [17] . Firstly, two distinct PCR products, A and B, were generated using template and primer pairs detailed in Table S1 . In the second round, PCR products A and B became the template for amplification with the forward primer of PCR A and reverse primer of PCR B resulting in a chimeric full-length product. This amplicon was shuttled into Blunt II TOPO (Invitrogen) prior to subcloning on HindIII/NotI site into pcDNA5/FRT/TO (Invitrogen). A hexa-histidine (His)-tag was inserted at the 5′ end of human IMPDH1 or IMPDH2 cDNA [35] by PCR prior to cloning into pET20b (+) (Novagen, Madison, WI, USA). QuikChange site-directed mutagenesis kit (Stragene, La Jolla, CA, USA) was used to introduce point mutations, CGC to CCC (R224P) and GAC to AAC (D226N).

Cell Culture Chinese Hamster Ovary

(CHO) cells and HeLa cells were cultured in complete F12 HAMs and Dulbecco's Modified Eagle's medium respectively, supplemented with 10% FBS and 2 mM L-glutamine. Cells were transfected and treated as previously described [9] . HeLa cells stably expressing HA-IMPDH2-GFP were initially selected, and subsequently maintained, with geneticin (600 µg/ml) added to the media 24 h post transfection with the pmEGFP-C1 HA-IMPDH2-GFP plasmid. A population of cells with a low fluorescence, due to low expression of HA-IMPDH2-GFP, were further selected by fluorescence activated cell sorted analysis. The resulting heterogeneous stable population of cells expressed HA-IMPDH2-GFP at approximately 10% of the level of endogenous IMPDH. Cells were treated with either vehicle, 2 µM MPA for either 4 h or as indicated or 2 µM MPA for 4 h and supplemented with 100 µM guanosine for the final 2 h.

Immunofluorescence and time-lapse videomicroscopy

Indirect immunofluorescence microscopy was performed as previously described [9] with cells being imaged on a LSM510 META confocal microscope at 100× magnification (Carl Zeiss MicroImaging, Jena, Germany). For 3D time-lapse (4D) videomicroscopy, HeLa HA-IMPDH2-GFP cells were cultured on 24 mm glass bottomed dishes (Proscitech, Qld, Australia). Cells were washed with PBS and complete F12 HAMS prior to replacing with complete F12 HAMS containing the inhibitors. Cells were then imaged, on a pre-heated (37°C) stage top insert with 5% humidified CO 2 circulating, through a C-Apochromat 40×/1.20 W Korr UV-VIS-IR M27 objective using 4–6% 488 nm laser intensity on a LSM510 META confocal microscope (Zeiss). Confocal Z-series (0.9–1.1 µm increments) were acquired over time using the LSM software (Zeiss) and collected images were processed, analysed and movies constructed using Image J v1.41 software (NIH). All images and movies are maximum intensity projections of the 3D image. Electron microscopy and correlative light and electron microscopy CHO cells were fixed with 0.1% glutaraldehyde/4% PFA and processed for EM as previously described [54] . Sections were labelled with antibodies to IMPDH followed by 10 nm protein A-gold. For cryofixation and correlative light and electron microscopy, HeLa cells selected for stable low expression of HA-IMPDH2-GFP were treated with MPA and then high pressure frozen, freeze substituted and embedded in HM20 resin at low temperature as described previously [55] with modifications to the Lowicryl HM20 infiltration which was shortened to one day (50%, 75% and 100% for 1 h each followed by two 12 h 100% infiltrations all at −50°C). Sections were labelled with antibodies to GFP followed by 10 nm protein A-gold. In silico analysis UCSF Chimera (version 1.3; [56] ) was used to coordinate superimposition of protein data bank files for human IMPDH2 (1B3O; [24] ) and IMPDH1 (1JCN; [25] ), utilising the default parameters of the matchmaker function, and for the structure visualisation.

Protein purification

Escherichia coli BL21 (DE3) transformed with pET20b constructs were induced at room temperature (RT) for 12–14 h by addition of isopropyl-beta-D-thiogalactopyranoside (1 mM). Cell pellets were resuspended in either binding buffer 1 (50 mM Tris pH 8.0, 100 mM KCl, 30 mM imidazole, 1.5 M urea, 10 mM 2-mercaptoethanol) for IMPDH1 proteins and the core protein or binding buffer 2 (50 mM Tris pH 6.8, 500 mM KCl, 30 mM imidazole) for IMPDH2, containing protease inhibitors (1 µg/ml leupeptin, 1 µg/ml pepstatin, 1 µg/ml antipain, 250 µM benzamidine and 3 mM AEBSF). Lysates were sonicated, centrifuged at 17000× g for 30 min at 4°C and His-IMPDH proteins purified on a talon affinity resin (Clontech) or nickel-nitriloacetic acid column (Invitrogen) according to the manufacturer's instructions. Protein was eluted with appropriate binding buffer containing 250 mM imidazole and dialysed into activity assay buffer (100 mM KCl, 100 mM Tris-HCl pH 8.0, 1 mM DTT) with glycerol added to a final concentration of 20% for storage. Protease protection assay Purified His-IMPDH protein (0.9 µM) was incubated for 20 min at RT with 1 mM nucleotides or 1 mM MPA with 1 mM IMP and NAD in activity assay buffer prior to addition of 20 µg/ml elastase for a further 20 min. Reactions were ceased by addition of Laemmli SDS-PAGE sample buffer and heat denaturation, then analysed by SDS-PAGE. Protein bands were visualised with coomassie staining and the full-length (intact) protein quantitated using the LI-COR Odyssey Infrared Imaging System. Percentage protection was calculated using the following formula: % protection = ((full-length protein remaining after digestion in sample/undigested protein) – (full-length protein remaining with elastase only digestion/undigested protein))×100%. [ 32 P] ATP filter binding assay The ATP binding assay was based on those previously described [22] , [23] , [57] . In brief, purified His-IMPDH protein (0.9 µM), or BSA (used as a negative control), was mixed with 1 µM [α- 32 P] ATP (800 Ci/mmol; Perkin Elmer, Waltham, MA, USA) and cold ATP (5 µM or 100 µM) for 20 min at RT in binding buffer (50 µl total reaction −100 mM KCl, 100 mM Tris-HCl pH 8.0, 1 mM DTT and 2.5 µM BSA) in duplicate. Reactions were terminated by rapid filtration, loading 15 µl onto 3× pre-equilibrated (in binding buffer) MF filter membrane discs (Millipore, Billerica, MA, USA) under vacuum. Filters were washed rapidly (