⭐ High Impact

Electron tomography reveals Rab6 is essential to the trafficking of trans-Golgi clathrin and COPI-coated vesicles and the maintenance of Golgi cisternal number.

Storrie Brian, Micaroni Massimo, Morgan Garry P, Jones Nick, Kamykowski Jeffrey A, Wilkins Ngozi, Pan Timothy H, Marsh Brad J

📰 Traffic (Copenhagen, Denmark) 📅 2012 📊 75 citations

Abstract

We have shown previously that Rab6, a small, trans‐Golgi‐localized GTPase, acts upstream of the conserved oligomeric Golgi complex (COG) and ZW10/RINT1 retrograde tether complexes to maintain Golgi homeostasis. In this article, we present evidence from the unbiased and high‐resolution approach of electron microscopy and electron tomography that Rab6 is essential to the trans‐Golgi trafficking of two morphological classes of coated vesicles; the larger corresponds to clathrin‐coated vesicles and the smaller to coat protein I (COPI)‐coated vesicles. On the basis of the site of coated vesicle accumulation, cisternal dilation and the normal kinetics of cargo transport from the endoplasmic reticulum (ER) to Golgi followed by delayed Golgi to cell surface transport, we suggest that Golgi function in cargo transport is preferentially inhibited at the trans‐Golgi/trans‐Golgi network (TGN). The >50% increase in Golgi cisternae number in Rab6‐depleted HeLa cells that we observed may well be coupled to the trans‐Golgi accumulation of COPI‐coated vesicles; depletion of the individual Rab6 effector, myosin IIA, produced an accumulation of uncoated vesicles with if anything a decrease in cisternal number. These results are the first evidence for a Rab6‐dependent protein machine affecting Golgi‐proximal, coated vesicle accumulation and probably transport at the trans‐Golgi and the first example of concomitant cisternal proliferation and increased Golgi stack organization under inhibited transport conditions.

🔬 Techniques

🔭 Microscopes

✨ Fluorophores

GFP

🧪 Sample Preparation

🔬 Cell Lines

🏭 Microscope Brands

Zeiss Leica Olympus Gatan JEOL FEI Evident (Olympus)

🧪 Reagent Suppliers

📷 Detectors

💻 Software Details

Image Analysis:
ImageJ Digital Micrograph IMOD SerialEM

🏛️ Research Organizations (ROR)

Affiliated research institutions:

📋 Methods

✔ Verified methods section 1,936 words Read on PMC ↗

Cell Culture Wild-type

HeLa cells were grown in DMEM supplemented with 10% fetal bovine serum (FBS) in a humidified incubator at 37°C and 5% CO 2 . HeLa cells stably expressing GalNAcT2-GFP (N-acetylgalactosaminyltransferase-2 fused to the green fluorescent protein (GFP)) were maintained in culture in the presence of G-418 ( 54 ). All cell culture media, sera and associated reagents were obtained either from Invitrogen or the Sigma Chemical Co. RNA Interference (RNAi) and Nocodazole Treatment siRab6(Sun) (starting at nucleotide position 554 within the coding sequence of Rab6) used to deplete endogenous Rab6 protein levels in HeLa cells in most experiments was manufactured by Dharmacon RNA Technologies (Lafayette, CO, USA) and was directed against a 3’ portion of Rab6 mRNA that is common to both the Rab6a and Rab6a’ isoforms generated by alternative splicing of the Rab6A gene ( 9 , 55 ). Consequently, we use the term ‘Rab6’ in this paper to collectively refer to both splice variants. Rab6a and Rab6a’ differ by only three amino acids, share the same GTP binding properties, localize to the Golgi and are at least partially functionally redundant ( 12 , 55 ). Under the conditions used in our experiments, we achieved a 75–95% depletion of Rab6 by RNAi knockdown over a 72–96 h period ( Figures 1C , 2C and 3G ) ( 9 ) accompanied by a high level of phenotypic penetrance (95–96%, data not shown), consistent with previous results ( 9 ). In some experiments, an alternate siRNA directed against the 5’ third of Rab6 starting at nucleotide position 78 (siRab6(Young), 12) was used. For MyoIIA knockdown, the following siRNA: AGGAGUUUCGGCAGAGAGAUAUU, synthesized by Dharmacon was used ( 11 ). siRNA transfections using Oligofectamine (Invitrogen) were carried out in the absence of FBS using previously described protocols with only minor modifications ( 9 , 12 ). In brief, 70,000 cells in a 35 mm dish underwent two successive cycles of siRNA transfection for maximal knockdown; the second cycle started 24 h after the initial incubation (Sun et al., 2007). Protein depletion times are referenced to the first transfection cycle. The scrambled siControl RNA has been described previously ( 9 ). siControl and siRab6 HeLa cell cultures were exposed to nocodazole as previously described ( 54 , 56 ).

Show full methods section

Cell Culture Wild-type

HeLa cells were grown in DMEM supplemented with 10% fetal bovine serum (FBS) in a humidified incubator at 37°C and 5% CO 2 . HeLa cells stably expressing GalNAcT2-GFP (N-acetylgalactosaminyltransferase-2 fused to the green fluorescent protein (GFP)) were maintained in culture in the presence of G-418 ( 54 ). All cell culture media, sera and associated reagents were obtained either from Invitrogen or the Sigma Chemical Co. RNA Interference (RNAi) and Nocodazole Treatment siRab6(Sun) (starting at nucleotide position 554 within the coding sequence of Rab6) used to deplete endogenous Rab6 protein levels in HeLa cells in most experiments was manufactured by Dharmacon RNA Technologies (Lafayette, CO, USA) and was directed against a 3’ portion of Rab6 mRNA that is common to both the Rab6a and Rab6a’ isoforms generated by alternative splicing of the Rab6A gene ( 9 , 55 ). Consequently, we use the term ‘Rab6’ in this paper to collectively refer to both splice variants. Rab6a and Rab6a’ differ by only three amino acids, share the same GTP binding properties, localize to the Golgi and are at least partially functionally redundant ( 12 , 55 ). Under the conditions used in our experiments, we achieved a 75–95% depletion of Rab6 by RNAi knockdown over a 72–96 h period ( Figures 1C , 2C and 3G ) ( 9 ) accompanied by a high level of phenotypic penetrance (95–96%, data not shown), consistent with previous results ( 9 ). In some experiments, an alternate siRNA directed against the 5’ third of Rab6 starting at nucleotide position 78 (siRab6(Young), 12) was used. For MyoIIA knockdown, the following siRNA: AGGAGUUUCGGCAGAGAGAUAUU, synthesized by Dharmacon was used ( 11 ). siRNA transfections using Oligofectamine (Invitrogen) were carried out in the absence of FBS using previously described protocols with only minor modifications ( 9 , 12 ). In brief, 70,000 cells in a 35 mm dish underwent two successive cycles of siRNA transfection for maximal knockdown; the second cycle started 24 h after the initial incubation (Sun et al., 2007). Protein depletion times are referenced to the first transfection cycle. The scrambled siControl RNA has been described previously ( 9 ). siControl and siRab6 HeLa cell cultures were exposed to nocodazole as previously described ( 54 , 56 ).

Antibodies

Rabbit antibodies directed against Rab6, β-actin and TGN46 were purchased commercially and used as described elsewhere ( 9 , 44 , 57 ). Rabbit antibodies to β-COP were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA) and those against the C-terminal peptide of human MyoIIA were purchased from Covance, Inc (Princeton, NJ, USA). Monoclonal antibodies against gpp130, an ectoepitope of ts045-VSV-G protein, and β-COP were gifts from Adam Linstedt (Dept. of Biology, Carnegie Mellon University, Pittsburgh, PA, USA), Harvey Lodish (Dept. of Biology, Massachusetts Institute of Technology, Cambridge, MA, USA), and James E. Rothman (Department of Cell Biology, Yale University), respectively.

Chemical Fixation for Thin Section Electron Microscopy

RNAi treated cells were grown in 35 mm tissue culture dishes and fixed in situ with 0.05% malachite green, 2.5% glutaraldehyde in 0.1 M cacodylate buffer as described ( 58 ). Cells were then stained with osmium tetroxide followed by sequentially by tannic acid and uranyl acetate. Cells were then scraped off the tissue culture dish, dehydrated, and plastic embedded. Thin sections were cut at 40 or 50 nm thickness with a Leica UltraCut 7 microtome and examined at an accelerating voltage of 80 KeV with a Tecnai F20 intermediata voltage electron microscope (FEI Co.). Images were collected with a 4K FEI Eagle CCD camera.

Western Blot Analysis

HeLa cells were lysed in 2% SDS, followed by standard SDS-PAGE (12% acrylamide) and Western blotting essentially as previously described ( 9 , 59 ). Western blots were quantified using a LI-COR Odyssey system (LI-Cor Biosciences, Lincoln, NE). VSV-G Transfection and Chase After 80 h incubation with either scrambled (control) or siRNA against Rab6, wild type HeLa cells were transfected with plasmids encoding tsO45 mutant of VSV-G-GFP protein and incubated overnight at 39.5 C, non-permissive conditions for the transport of VSV-G protein from the ER to Golgi apparatus. Cells were then shifted to 32°C, permissive conditions for tsO45 G transport, and incubated for various chase in the presence of cycloheximide to prevent further protein synthesis. Cells were then fixed with paraformaldehyde and cell surface stained for VSV-G protein and subsequently intracellularly stained for Rab6 expression level. Under these conditions, the total siRNA treatment time was 4 d. Plasmid expression was deliberately chosen to give a low expression level for VSV-G protein.

Fluorescence Microscopy and Image Processing

To characterize protein distributions by immunofluorescence at the light microscope level, fixed cells were visualized either using a BD CARVII spinning disk confocal microscopy accessory mounted on a Zeiss 200M inverted microscope controlled by iVision-Mac software (BioVision Technologies, Exton, PA, USA) to give confocal image stacks or directly with the Zeiss 200M inverted microscope to give wide field micrographs. Images were collected with a 63x/1.40 numerical aperture objective and subsequently processed using iVision-Mac software. To assess qualitatively the effect of Rab6 knockdown on Golgi phenotype prior to correlative imaging at the electron microscopy level, GalNAcT2-GFP expressing HeLa cells treated with siRab6 (together with control HeLa cells transfected with scrambled/nonsense siRNA duplexes) cultured on gold EM finder grids (Electron Microscopy Sciences, Hatfield, PA, USA) were imaged at 37 °C using a heated stage mounted on a Zeiss LSM 510 microscope. Image stacks were taken as rapidly as possible at a spacing of 1 μm using a 63x/1.40 numerical aperture objective and a zoom factor of 0.7 or 1.0 to accommodate a large field of view. During image acquisition, HeLa cells were maintained in PBS supplemented with 2% FBS. Resulting image sets were compressed into maximum intensity projections using ImageJ software. To quantify the effects of nocodazole on the distribution of the Golgi marker, GalNAcT2-GFP, maximum intensity projections of full cell depth HeLa cell confocal image stacks were analyzed using iVision-Mac software. For the assessment of nocodazole scattered peripheral Golgi elements, a size criteria of 0.078 to 2.70 μm 2 (10–350 pixels, 0.0879 μm pixel size) was assigned and the number of GalNAcT2-GFP structures falling into that size was computer scored. For the assessment of BFA-induced Golgi dispersal to the ER, image segmentation of maximum intensity projections was used to determine total cell GalNAcT2-GFP fluorescence and juxtanuclear Golgi fluorescence. Golgi fluorescence was subtracted from total cell fluorescence to give ER associated Golgi fluorescence. To quantify total VSV-G protein distribution between a juxtanuclear Golgi accumulation and the ER, VSV-G-GFP expressing cells imaged with wide field optics and then juxtanuclear VSV-G-GFP and total cellular G protein were determined by outlining the appropriate areas manually and the mean pixel intensity in the juxtanuclear Golgi area and the total was determined with iVision-Mac software. To quantify VSV-G cell surface labeling, VSV-G plasmid transfected cells were surface labeled for extracellular VSV-G protein epitope and imaged. Stained cells were outlined manually and the mean pixel intensity per cell determined with iVision-Mac software. All pixel intensities were corrected for background fluorescence as determined by outlining non-cellular areas within the images. High-Pressure Freezing, Freeze-Substitution and Microtomy Following live cell imaging at 37 °C as described above to establish phenotype penetrance, both Rab6-depleted and control HeLa cells grown on gold finder grids were high-pressure frozen essentially as described previously ( 15 , 22 , 60 ). Solutions and metal specimen holders (Swiss Precision Inc., Millbrae, CA, USA) for high-pressure freezing were pre-warmed to 37 °C, and all manipulations were performed on an inverted heating block warmed to 37 °C under a dissecting microscope (Olympus, Australia). Following high-pressure freezing using either a BAL-TEC HPM010 or Leica EM PACT2 high-pressure freezing units (Leica Microsystems), cells frozen on grids were stored in liquid nitrogen. Specimens were freeze-substituted using a Leica AFS unit (Leica Microsystems) and then plastic-embedded essentially as described previously ( 15 , 22 , 60 ). Electron Microscopy and Cellular Electron Tomography The procedures used to prepare mammalian cells for electron microscopy/electron tomography imaging and subsequent 3D reconstruction using a dual-axis tomography approach have been described elsewhere in detail ( 15 , 22 , 60 – 62 ). Briefly, both thin (40–60 nm) and thick (300–400 nm) sections cut with a Leica UltraCut-UCT microtome were collected onto Formvar-coated copper slot grids and post-stained with aqueous uranyl acetate and Reynold’s lead citrate (Electron Microscopy Sciences, Hatfield, PA, USA) to enhance contrast/visualization. Thin sections were surveyed using a JEOL 1200 electron microscope (JEOL Australasia Pty Ltd.) operated at 80–120 KeV to assess the quality of ultrastructural preservation, collect sets of 2D images depicting representative Golgi regions in both Rab6-depleted and control cells, and for the identification of cells for subsequent tomographic imaging/reconstruction based on correlated light microscope images of the same grids prior to freezing. For electron tomography, thick sections were imaged with a Tecnai F30 intermediate-voltage electron microscope operated at 300 KeV (FEI Co.) using motorized tilt-rotate specimen holders (Models 650 and CT3500TR; GATAN Inc., Pleasanton, CA, USA). Tilt series datasets were collected at 20000 or 23000x magnification either by single panel CCD (charge-coupled device) imaging or by image montaging (2 × 2 panels) using automated data acquisition and image alignment routines as the grids housing the sections were serially tilted over a range of ~120° (±60°) and about two orthogonal axes using the microscope control program SerialEM ( 63 , 64 ). Tomograms computed from aligned 2D views for each single-axis dataset were computationally registered and combined in 3D space to produce a dual-axis tomogram for quantitative analysis that encompassed a cellular area measuring ~4.3 × 4.3 μm in X and Y, with a final pixel size of 2.144 nm, siControl and siRab6 samples and for siMyoIIA samples the cellular area was ~4.75 × 4.75 μm in XY, with a final pixel size of 1.26 nm. All of the above procedures - along with subsequent protocols for image segmentation, surface mesh computation/generation, 3-dimensional visualization and quantitative analysis - were performed using the IMOD software package maintained and distributed by the Boulder Laboratory for 3D Electron Microscopy of Cells at the University of Colorado (Boulder, CO, USA)( 65 ), essentially as described previously ( 15 , 22 ). Quantification of 2D images acquired from thin sections cut from high-pressure frozen cells was carried out for 11–14 cells for Rab6-depleted versus controls. High-resolution 3D reconstructions of the Golgi region generated for 4–5 cells for Rab6-depleted HeLa cells (likewise for controls) were qualitatively evaluated by comparison to one another, and to 2D images of thin sections as well as correlated light microscope data for Golgi phenotypes. Tomograms assessed as ‘representative’ for siRab6-treated versus control cells were subsequently segmented in 3D for detailed quantitative analysis and comparative 3D visualization of Golgi structure/organization. The color-coding for different segmented membranes and vesicles is listed for relevant Figures in the legend. siMyoIIA samples were handled similarly. Supplementary multimedia video files of the 3D datasets were made as QuickTime ® movies from file sequences generated directly from the 3dmod viewer window in IMOD . Movies of the 3D reconstructions with/without model contours overlaid as colored line segments were generated as the tomogram image slice was advanced in Z; movies of the surface-rendered models generated from cellular tomograms by meshing segmentation contours on adjacent image slices in Z display 3D models of the Golgi as they are incrementally rotated in X or Y to allow unobstructed views of the structures.

Supplementary Material Supp Movie S1 Supp Movie S10 Supp Movie S2 Supp Movie S3 Supp Movie S4 Supp Movie S5 Supp Movie S6 Supp Movie S7 Supp Movie S8 Supp Movie S9

📊 Figures

Fig. 1

Treatment of GalNAcT2-GFP HeLa cells with either of two different siRNAs directed against Rab6 results in a similarly expanded Golgi apparatus by electron microscopy

Cells were chemically fixed and then thin sectioned. A: Appearance of the Golgi apparatus (GA) in chemically fixed cells treated with a Control siRNA, extracellular space (Ex). B: Appearance of the Go...

Fig. 2

Rab6-depletion arrests Golgi vesicle release and results in increased cisternal number as well as increased lateral continuity along the length of the Golgi ribbon

HeLa cells stably expressing GalNAcT2-GFP were incubated with siControl (A) or siRNA sequences specific for both the Rab6a and Rab6au2019 isoforms (B) for 72 h, followed by processing for electron mic...

Fig. 3

Golgi stacks in Rab6-depleted cells retain a polarized distribution of resident Golgi proteins along the cis - trans axis

Wild-type HeLa cells incubated with either scrambled (siControl, A) or Rab6 siRNA (siRab6, B) for 96 h were fixed for indirect immunofluorescence localization using antibodies specific for p115 and u0...

Fig. 4

The Golgi ribbon in control cells is organized as a series of u2018compact regionsu2019 of stacked cisternae

HeLa cells were treated for 96 h with control siRNA and then high-pressure frozen immediately from 37u00b0C. (A) A representative Golgi ribbon is shown; inset - an example of ER membranes in close phy...

Fig. 5

The Golgi ribbon in Rab6-depleted cells exhibits elongated cisternae/lateral continuity, increased cisternal stacking and extensive arrest of vesicular budding

HeLa cells were incubated with siRab6 for 96 h then high pressure frozen immediately from 37u00b0C. (A) Tomogram; inset, 5.6x view of Z slices from area proximal to asterisk more clearly reveals the s...

Fig. 6

The Golgi in Rab6-depleted HeLa cells remains sensitive to nocodazole-induced microtubule depolymerization

GalNAcT2-GFP HeLa cells incubated with either scrambled (siControl, A and B) or Rab6 siRNA (siRab6, C and D) for 96 h were either fixed immediately or treated with nocodazole at 10 u03bcM for various ...

Fig. 7

The formation of multivesicular bodies/autophagic compartments is upregulated in Rab6-depleted cells

(A and B) Tomograms show the formation of extended endo-membrane compartments containing multiple/internal membranes and abundant coated vesicle profiles. (Au2032 and Bu2032) Higher magnification view...

Fig. 8

Depletion of Rab6 inhibits VSV-G transport Golgi to cell surface, but not from the ER to Golgi apparatus

Wild-type HeLa cells were either incubated with Control or Rab6 (Sun) siRNAs for 4 d and then microinjected with plasmids encoding GFP tagged VSV-G protein. At the end of the expression period at 39.5...

Fig. 9

Small uncoated Golgi-associated vesicles and tubules accumulate with selective depletion of the Rab6-effector MyoIIA indicating the specificity of the Rab6-knockdown Golgi phenotype

(A) Thin section electron micrograph of the Golgi region in a MyoIIA-depleted HeLa cell. Arrow points to an example of beads-on-a-string set of vesicles and a membrane-linked, stalked vesicle. (B) Tom...

Figure images are served from the NIH/NLM PubMed Central Open Access Subset or Europe PMC; copyright remains with the publishers and authors.

🏛️ Imaging Facility

🏛️ University of Arkansas for Medical Sciences

💬 Discussion

0 comments

No comments yet. Be the first to start a discussion!

Leave a Comment

MicroHub Assistant