⭐ High Impact

Monitoring astrocyte calcium microdomains with improved membrane targeted GCaMP reporters.

Shigetomi Eiji, Kracun Sebastian, Khakh Baljit S

📰 Neuron glia biology 📅 2010 📊 92 citations

Abstract

Astrocytes are involved in synaptic and cerebrovascular regulation in the brain. These functions are regulated by intracellular calcium signalling that is thought to reflect a form of astrocyte excitability. In a recent study, we reported modification of the genetically encoded calcium indicator (GECI) GCaMP2 with a membrane-tethering domain, Lck, to generate Lck-GCaMP2. This GECI allowed us to detect novel microdomain calcium signals. The microdomains were random and 'spotty' in nature. In order to detect such signals more reliably, in the present study we further modified Lck-GCaMP2 to carry three mutations in the GCaMP2 moiety (M153K, T203V within EGFP and N60D in the CaM domain) to generate Lck-GCaMP3. We directly compared Lck-GCaMP2 and Lck-GCaMP3 by assessing their ability to monitor several types of astrocyte calcium signals with a focus on spotty microdomains. Our data show that Lck-GCaMP3 is between two- and four-times better than Lck-GCaMP2 in terms of its basal fluorescence intensity, signal-to-noise and its ability to detect microdomains. The use of Lck-GCaMP3 thus represents a significantly improved way to monitor astrocyte calcium signals, including microdomains, and will facilitate detailed exploration of their molecular mechanisms and physiological roles.

🔬 Techniques

✨ Fluorophores

🧪 Sample Preparation

🔬 Cell Lines

🏭 Microscope Brands

Andor Till Photonics Molecular Devices

🧪 Reagent Suppliers

📷 Detectors

🔎 Objectives

💻 Software Details

Image Analysis:
ImageJ

🏛️ Research Organizations (ROR)

Affiliated research institutions:

📋 Methods

✔ Verified methods section 925 words Read on PMC ↗

Molecular biology Lck-GCaMP2 was available from previous work and was generated from GCaMP2 as recently described ( Shigetomi et al. , 2010 ). Lck-GCaMP3 was generated by three rounds of site-directed mutagenesis (Quick Change, Stratagene) of Lck-GCaMP2 to sequentially introduce the following single-site mutations: M153K, T203V (in EGFP) and N60D (in CaM) ( Tian et al. , 2009 ). The following primers were used: M153K: (+) CGAGAACGTCTATATCAAGGCCGACAAGCAGAAG, (−) CTTCTGCTTGTCGGCCTTGATATAGACGTTCTCG; T203V: (+) CAACCACTACCTGAGCGTCCAGTCCAAACTTTCG, (−) CGAAAGTTTGGACTGGACGCTCAGGTAGTGGTTG; N60D: (+) GTAGATGCCGACGGTGATGGCACAATCGACTTC, (−) GAAGTCGATTGTGCCATCACCGTCGGCATCTAC All intervening and final constructs were verified by DNA sequencing. Lck-GCaMP2 has been deposited at Addgene ( www.addgene.org ) for distribution; Lck-GCaMP3 will be similarly made available.

HEK-293 cell culture

HEK-293 cells (obtained from ATCC) were maintained in 75 cm 2 cell culture flasks in DMEM/F12 media with Glutamax (Invitrogen) supplemented with 10% foetal bovine serum and penicillin/streptomycin. Cells were grown in a humidified atmosphere of 95% air/5% CO 2 at 37°C in a cell culture incubator. The cells were split 1 in 10 when confluence reached 60–90%, which was generally every 3–4 days. Cells were prepared for transfection by plating onto six-well plates at the time of splitting 3–4 days before transfection. They were transfected at 60–90% confluence. For transient expression in HEK-293 we used 0.5–1 μg plasmid cDNA and the Effectene transfection reagent (Qiagen) for each well of a six-well plate. The manufacturer’s instructions were followed with 4 μl of enhancer and 10 μl of Effectene used for each transfection. Buffered calcium solutions used for determining the calcium Kd of Lck-GCaMP2 were made in HEK cell buffer (in mM: 150 NaCl, 1 MgCl 2 , 10 D-glucose, 10 HEPES, 1 EGTA at pH7.5 (adjusted with NaOH)) with the aid of the MaxChelator Program ( Bers et al. , 1994 ) to calculate the amount of CaCl 2 added to achieve a particular final concentration. To achieve permeabilisation, cells were treated with 0.1% TritonX-100 (without calcium) for 15–30 s. The cells were then washed three times with zero calcium buffer and imaged as described below.

Show full methods section

Molecular biology Lck-GCaMP2 was available from previous work and was generated from GCaMP2 as recently described ( Shigetomi et al. , 2010 ). Lck-GCaMP3 was generated by three rounds of site-directed mutagenesis (Quick Change, Stratagene) of Lck-GCaMP2 to sequentially introduce the following single-site mutations: M153K, T203V (in EGFP) and N60D (in CaM) ( Tian et al. , 2009 ). The following primers were used: M153K: (+) CGAGAACGTCTATATCAAGGCCGACAAGCAGAAG, (−) CTTCTGCTTGTCGGCCTTGATATAGACGTTCTCG; T203V: (+) CAACCACTACCTGAGCGTCCAGTCCAAACTTTCG, (−) CGAAAGTTTGGACTGGACGCTCAGGTAGTGGTTG; N60D: (+) GTAGATGCCGACGGTGATGGCACAATCGACTTC, (−) GAAGTCGATTGTGCCATCACCGTCGGCATCTAC All intervening and final constructs were verified by DNA sequencing. Lck-GCaMP2 has been deposited at Addgene ( www.addgene.org ) for distribution; Lck-GCaMP3 will be similarly made available.

HEK-293 cell culture

HEK-293 cells (obtained from ATCC) were maintained in 75 cm 2 cell culture flasks in DMEM/F12 media with Glutamax (Invitrogen) supplemented with 10% foetal bovine serum and penicillin/streptomycin. Cells were grown in a humidified atmosphere of 95% air/5% CO 2 at 37°C in a cell culture incubator. The cells were split 1 in 10 when confluence reached 60–90%, which was generally every 3–4 days. Cells were prepared for transfection by plating onto six-well plates at the time of splitting 3–4 days before transfection. They were transfected at 60–90% confluence. For transient expression in HEK-293 we used 0.5–1 μg plasmid cDNA and the Effectene transfection reagent (Qiagen) for each well of a six-well plate. The manufacturer’s instructions were followed with 4 μl of enhancer and 10 μl of Effectene used for each transfection. Buffered calcium solutions used for determining the calcium Kd of Lck-GCaMP2 were made in HEK cell buffer (in mM: 150 NaCl, 1 MgCl 2 , 10 D-glucose, 10 HEPES, 1 EGTA at pH7.5 (adjusted with NaOH)) with the aid of the MaxChelator Program ( Bers et al. , 1994 ) to calculate the amount of CaCl 2 added to achieve a particular final concentration. To achieve permeabilisation, cells were treated with 0.1% TritonX-100 (without calcium) for 15–30 s. The cells were then washed three times with zero calcium buffer and imaged as described below.

Epifluorescence microscopy

Briefly, we used an Olympus IX71 microscope equipped with an IXON DV887DCS EMCCD camera (Andor), epifluorescence condenser, control unit and Polychrome V monochromator (TILL Photonics). The control of excitation and image acquisition was achieved using TILLVision software. We used an Olympus 60X 1.45 NA objective lens. Images were typically taken every one second. Exposure time and pixel binning were optimised to visualise fluorescence signals for each experiment (maximum binning was 4 × 4). Cultures were perfused with recording buffer (110 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl 2 , 0.8 mM MgCl 2 , 10 mM D-glucose, 10 mM HEPES at pH 7.4 (adjusted with NaOH)).

Hippocampal astrocyte–neuron cultures

Hippocampal cultures were prepared as described ( Shigetomi and Khakh, 2009 ). Briefly, two rat pups at P1–2 (Charles River) were used each week for hippocampal cultures for each dissection. For the experiments reported in this study, we used 105 coverslips from 42 rat pups over the course of one year’s experiments. Hippocampi were dissected in Petri dishes filled with ice-cold medium. The dissected hippocampi (in medium, on ice) were cut and then digested with 20 U/ml papain for 11–13 min at 37°C (Worthington PAPAIN-022). After the incubation, the pieces were washed with pre-warmed media and triturated with flame-polished pipettes of progressively smaller bores; 120,000 cells (for 22 mm coverslips, VWR) or 20,000 cells (for 12 mm coverslips, VWR) were used for plating onto each coverslip. The coverslips were previously coated with poly-D-lysine (50 μg/ml; Sigma) and then overnight with 400 μl (for 22 mm coverslips) or 100 μl (for 12 mm coverslips) of 20 μg/ml laminin (Sigma) in sterile dissection medium. One hour after plating the cells were fed with 2 ml of pre-warmed culture medium.

Astrocyte transfection

Before transfection, half of the media was removed and the astrocytes fed with fresh media that had been pre-warmed to 37°C for more than 30 min. The removed media was supplemented with an equal volume of new media and stored in the cell culture incubator (this is the ‘fed and conditioned medium’). For EFS experiments, we used neurobasal-based media to keep neurons healthy. We transfected astrocytes at 4–6 days in culture with the Effectene transfection reagent (Qiagen) or Lipofectamine 2000 (Invitrogen). Experiments were carried out within 3 days of transfection.

Agonist applications and electrical field stimulation

Drugs were applied to single cells using a Warner Instrument VC–8 valve controller or to all cells on the glass coverslip in the bathing medium (at 2–3 ml/min). We used a microscope stage-mounted glass bottom chamber with built-in platinum electrodes (Warner Instruments) connected to a Grass S88 stimulator for field stimulation as previously described ( Richler et al. , 2008 ). We used a pulse width of 100 μs and a stimulation frequency of 30 Hz (stimulus intensity was 85–90 V). For EFS experiments we used a static bath.

Data analysis

Image analysis was performed with ImageJ (NIH) and Clampfit 10.2 (Molecular Devices Inc.). Calcium signals above two standard deviations of the mean of a baseline region were collected for analysis. All statistical tests were run in GraphPad Instat 3.06 (GraphPad Software Inc.) and OriginPro 8 (OriginLab Corp.), which was also used for creating graphs. Statistical significance was declared at a P value of

📊 Figures

Fig. 1

Design and characterisation of Lck-GCAMP3

(A) Schematic representation of cytosolic GCaMP2, Lck-GCaMP2 and Lck-GCaMP3. Lck-GCaMP3 was made by introduction of three point mutations into Lck-GCaMP2 as indicated by green circles. The numbering s...

Fig. 2

Comparison between Lck-GCaMP3 and Lck-GCaMP2 in basal fluorescence and ATP-evoked calcium signals in astrocytes

(A) Representative images of Lck-GCaMP2 ( n = 30 cells, five coverslips) and Lck-GCaMP3 expressing astrocytes ( n = 30 cells, six coverslips). Lck-GCaMP3 was brighter than Lck-GCaMP2. The histogram sh...

Fig. 3

Responses of astrocytes expressing Lck-GCaMP3 during EFS (EFS) of neurons

(A) Representative images of an astrocyte expressing Lck-GCaMP3 before and during EFS. (B) Traces from 13 astrocytes from four coverslips (grey) along with their averages superimposed (black) showing ...

Fig. 4

Microdomain signals measured with Lck-GCaMP3 in astrocytes

(A) A maximum projection image of a 300-frame movie acquired at 1 Hz (see supplementary movie 1 online). Six regions of interest are shown (as 1u20136). The intensity profiles of these six ROIs are sh...

Fig. 5

Comparing Lck-GCaMP3 and Lck-GCaMP2 in their ability to monitor microdomain calcium signals in astrocytes

(A) A d F / F image of spontaneous calcium signals in an astrocyte with Lck-GCaMP3. Dashed line shows the outline of the imaged astrocyte and white arrow points to a microdomain. Note that the high si...

Figure images are served from the NIH/NLM PubMed Central Open Access Subset or Europe PMC; copyright remains with the publishers and authors.

🏛️ Imaging Facility

🏛️ University of California Los Angeles

💬 Discussion

0 comments

No comments yet. Be the first to start a discussion!

Leave a Comment

MicroHub Assistant