Quantifying β-catenin subcellular dynamics and cyclin D1 mRNA transcription during Wnt signaling in single living cells.

Cells and transfections HEK293 Flp-in CCND1-MS2 cells ( Yunger et al., 2010 ) were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Biological Industries, Israel) containing 10% FBS (HyClone Laboratories, Logan, UT) and hygromycin selection (100 µg/ml; Sigma, Israel). Stable expression of MS2-GFP was obtained by co-transfection of the cells with MS2-GFP (10 µg) and puromycin resistance (300 ng) plasmids using calcium phosphate transfection, and selection with puromycin (1 μg/ml; Invivogen, San Diego, CA) and hygromycin (100 µg/ml). Stable expression of YFP-β-catenin ( Krieghoff et al., 2006 ) (10 µg) was performed by calcium phosphate transfection, and selection with neomycin (500 μg/ml; Sigma) and hygromycin (100 µg/ml). Cells with very low expression levels were collected by FACS (FACSAria III, BD Biosciences). Transient expression of YFP-β-catenin was performed using PolyJET (SignaGen, Israel). For generating Wnt3a conditioned medium (CM) and mock CM, L-Wnt-3A and L- mouse fibroblast cells were grown in DMEM and 10% FBS, and CM was prepared according to the American Tissue Culture Collection (ATCC) instructions ( Shibamoto et al., 1998 ). Wnt activation was performed with either Wnt3a-CM or with recombinant human Wnt3a (200 ng/ml; R& D Systems, Minneapolis, MN). Wnt3a-CM or mock-CM were added 1:1 to the volume of the cells medium. Cells were also treated with LiCl (20 mM; Sigma) and MG132 (20 µM; Sigma). The Fucci system (Clontech, Mountain View, CA) was used for cell cycle phase detection. For G1 phase detection, the pRetroX-G1-Red vector (mCherry-hCdt1) was used, and for S/G2/M phase the pRetroX-SG2M-Cyan vector (AmCyan-hGeminin). The Fucci system, being a viral-based system first required the introduction of the mouse ecotropic retroviral receptor on the membrane surface of HEK293 CCND1-MS2 cells expressing YFP-β-catenin. Transient transfection was performed 24 hr prior to infection using PolyJet transfection with the pBABE ecotropic receptor plasmid (Addgene #10687, Cambridge, MA). This step was performed twice for each infection. After mCherry-hCdt1 infection, mCherry positive cells were collected by FACS and maintained in medium containing puromycin (1 μg/ml; Invivogen). Cells were then transfected with the pBABE ecotropic receptor plasmid and 24 hr post-transfection, the cells infected with AmCyan-hGeminin. Positive cells were collected by FACS and maintained in medium containing neomycin (500 μg/ml) and puromycin (1 μg/ml). For infections, HEK293T cells were maintained in DMEM containing 10% FBS and used to package the Fucci retroviruses, which were collected over a period of three days before infecting the ecotropic HEK293 cells.

Western blotting

SDS-PAGE and Western blotting were performed as previously described ( Aizer et al., 2008 ). Primary antibodies used were mouse anti-β-catenin (BD Transduction Laboratories, cat# 610154, San Jose, CA) and rabbit anti-tubulin (Abcam, Cambridge, MA). The secondary antibody was an HRP-conjugated goat anti-rabbit or anti-mouse IgG (Sigma). Immunoreactive bands were detected by the Enhanced Chemiluminescence kit (ECL, PierceThermo scientific, Waltham, MA). Experiments were performed three times. Luciferase assay HEK293 CCND1-MS2 cells were co-transfected with the cyclin D1 promoter −1745CD1LUC Firefly luciefarse construct ( Albanese et al., 1995 ) and either YFP-β-catenin or eYFP-C1 (mock), together with a Renilla luciferase construct using PolyJet transfection. 50 ng of each plasmid were used. A luciferase assay was performed after 24 hr using the Dual-Glo Luciferase assay system (Promega, Madison, WI). After standardization with Renilla luciferase activity, a relative luciferase activity was obtained and the mean and standard deviation from triplicate wells was calculated. Each experiment was performed three times. YFP-β-catenin ( Krieghoff et al., 2006 ) was obtained from Jürgen Behrens (University of Erlangen-Nürnberg).

Flow cytometry

Cells were harvested and DNA quantification was performed using 5 μg/ml DAPI solution (Sigma). The BD FACSAria III cell sorter was used. For quantifying DNA in fixed cells, we used a 405 nm laser for excitation and a 450/40 nm bandpass filter for detection. Data were processed and analyzed using FlowJo software. The average quantification of 3 repeated experiments is presented (mean ± sd).

Immunofluorescence

Cells were grown on coverslips coated by Cell-Tak (BD Biosciences), washed with PBS and fixed for 20 min in 4% PFA. Cells were then permeabilized in 0.5% Triton X-100 for 3 min. After blocking, cells were immunostained for 1 hr with a primary antibody, and after subsequent washes the cells were incubated for 1 hr with secondary fluorescent antibodies. Primary antibodies: mouse anti-β-catenin and rabbit anti-pericentrin (Abcam, cat# ab4448). Secondary antibodies: Alexa488-labeled goat anti-mouse IgG and Alexa594-labeled goat anti-rabbit (Invitrogen, Carlsbad, CA). Nuclei were counterstained with Hoechst 33342 (Sigma) and coverslips were mounted in mounting medium.

Fluorescence in situ hybridization

CCND1-MS2 cells were grown on coverslips coated by Cell-Tak (BD Biosciences) and fixed for 20 min in 4% paraformaldehyde, and overnight with 70% ethanol at 4°C. The next day cells were washed with 1x PBS and treated for 2.5 min with 0.5% Triton X-100. Cells were washed with 1x PBS and incubated for 10 min in 40% formamide (4% SSC; Sigma). Cells were hybridized overnight at 37°C in 40% formamide with a specific fluorescently-labeled Cy3 DNA probe (~10 ng probe, 50 mer). The next day, cells were washed twice with 40% formamide for 15 min and then washed for two hours with 1X PBS. Nuclei were counterstained with Hoechst 33342 and coverslips were mounted in mounting medium. The probe for the MS2 binding site was: CTAGGCAATTAGGTACCTTAGGATCTAATGAACCCGGGAATACTGCAGAC. mRNA quantification 3D stacks (0.2 µm steps, 76 or 51 planes) of the total volume of the cells were collected from fixed CCND1-MS2 cells. The 3D stacks were deconvolved and the specific signals of mRNAs were identified (Imaris, Bitplane). mRNA identification was performed in comparison to deconvolved stacks from cells not containing the MS2 integration, which therefore served as background levels of nonspecific fluorescence. No mRNAs were identified in control cells. The sum of intensity for each mRNA particle and active alleles was measured in the same cells using Imaris, as previously described ( Yunger et al., 2010 , 2013 ). The single mRNA intensities were pooled and the frequent value was calculated. The sum of intensity at the transcription site was divided by the frequent value of a single mRNA. This ratio provided the number of mRNAs associated with the transcription unit from the point of the MS2-region and onwards. As mRNAs should be associated with a polymerase, this number should reflect the maximum number of polymerases engaged with this region. Quantification and counting experiments were applied to experiments performed on different days. Fluorescence microscopy, live-cell imaging and data analysis Wide-field fluorescence images were obtained using the Cell^R system based on an Olympus IX81 fully motorized inverted microscope (60X PlanApo objective, 1.42 NA) fitted with an Orca-AG CCD camera (Hamamatsu) driven by the Cell^R software. Live-cell imaging was carried out using the Cell^R system with rapid wavelength switching. For time-lapse imaging, cells were plated on glass-bottomed tissue culture plates (MatTek, Ashland, MA) coated by Cell-Tak (BD Biosciences) in medium containing 10% FBS at 37°C. The microscope is equipped with an incubator that includes temperature and CO 2 control (Life Imaging Services, Reinach, Switzerland). For long-term imaging, several cell positions were chosen and recorded by a motorized stage (Scan IM, Märzhäuser, Wetzlar-Steindorf, Germany). In these experiments, HEK293 Flp-in CCND1-MS2 expressing MS2-GFP cells were imaged in 3D (26 planes per time point) every 15 min, at 0.26 µm steps for 6 hr. HEK293 Flp-in CCND1-MS2 cells expressing YFP-β-catenin were imaged in 3D (15 planes per time point) at 0.7 µm steps, every 15 min, up to 18 hr. For presentation of the movies, the 4D image sequences were transformed into a time sequence using the maximum or sum projection options or manually selecting the in-focus plane using the ImageJ software. Time-lapse data were collected from single cells in several fields and on several days until reaching an appropriate sample size, and then all single-cell data were pooled and either averaged and presented as plots, or presented as single cell data.

Tracking and data analysis

The intensity of the active transcription sites labeled with MS2-GFP fluorescence in time-lapse movies was corrected for photobleaching using ImageJ, and the 3D movies were transformed to 2D by choosing the in-focus plane in which the intensity of the transcription site is the highest. Movies were manually tracked and the intensity measured for each frame ( Is ). Background from another location in the nucleus ( In ) was subtracted for each frame, and the final intensity was calculated using: I = Is(t) − In(t) and then normalized to the initial intensity. Measuring the intensity of the YFP-β-catenin signal in the subcellular compartments was performed manually using ImageJ, and background was subtracted from all measurements. When YFP-β-catenin levels were low, DIC images that were acquired in parallel were used for nucleus detection. For measurements of centrosome intensity, the intensity of the centrosome in each frame ( Ic) was multiplied by the area occupied by the centrosome ( Ac ): I = Ic(t) *Ac(t) . For membrane intensity, a sum projection of the 3D movies was used. Intensity was normalized either to the initial frame or to the highest intensity measured. The values of the nucleus/cytoplasm (N/C) ratio of YFP-β-catenin were obtained by division of the YFP-β-catenin intensity levels measured. Correlation coefficient values were calculated by comparing the intensity of β-catenin over time between all possible pairs of sub-cellular compartments, from Wnt activation onset. Values of rate of change ( Δ I / Δ t ) in YFP-β-catenin in the sub-cellular compartments over time were obtained by measuring the intensity difference ( Δ I ) between two consecutive time points divided by the time difference ( Δ t ) between the two time points: Δ I Δ t ( t ) n + 1 2 = I ( t ) n + 1 − I ( t ) n t n + 1 − t n FRAP and FLIP FRAP and FLIP experiments were performed using a 3D-FRAP system (Photometrics) built on an Olympus IX81 microscope (636 Plan-Apo, 1.4 NA) equipped with an EM-CCD (Quant-EM, Roper), 491 nm laser, Lambda DG-4 light source (Sutter), XY and Z stages (Prior), and driven by MetaMorph (Molecular Devices). Experiments were performed at 37°C with 5% CO 2 using a live-cell chamber system (Tokai). For each acquisition, YFP-β-catenin was bleached using the 491 nm laser. Six pre-bleach images were acquired. In FRAP, post-bleach images were acquired every 0.8 s for 80 s in the cytoplasm and the nucleus, every 1 s for 2 min in adherens junctions, every 0.4 s for 40 s at the centrosome, and every 1.5 s for 8 min to measure nuclear import and export rates. In FLIP, images were acquired every 1.9 s for 280 s in the cytoplasm and the nucleus. The experiments were analyzed using ImageJ macros previously described ( Aizer et al., 2008 ). Data from at least 10 experiments for each cell line were collected and the averaged FRAP and FLIP measurements were fitted by Matlab with a double exponential model: I ( t ) = α 1 * exp ( − τ 1 * t ) + α 2 * exp ( − τ 2 * t ) + c Where t = 0 is the time immediately after photobleaching. t 0.5 was defined as time where I ( t = t 0.5 ) = I ( t = ∞ ) 2 . Modeling β-catenin dynamics We used a simple model for describing β-catenin concentration ( C ) dynamics in the nucleus based on the data presented in the plot from Figure 2c : d C d t = P ( t ) − α ( t ) C Where α is the time dependent degradation rate, and P is the time dependent production rate. Both rates are allowed to change when t = T : α ( t ) = { α 1 ; f o r t ≤ T α 2 ; f o r t > T P ( t ) = { P 1 ; f o r t ≤ T P 2 ; f o r t > T The solution is: C ( t ) = { [ C ( 0 ) − P 1 α 1 ] ∗ e − α 1 ∗ t + P 1 α 1 ; f o r t ≤ T [ C ( T ) − P 2 α 2 ] ∗ e − α 2 ∗ ( t − T ) + P 2 α 2 ; f o r t > T Where: C ( T ) = [ C ( 0 ) − P 2 α 1 ] * e − α 1 * t + P 2 α 1 We fit the model by minimizing the sum of the squares of the residuals with the function ‘fmincon’ in MATLAB using the ‘active-set’ algorithm.

Statistical analysis

Two tailed t-test was performed in the following experiments: Quantitative FISH, Luciferase assay, the N/C ratio of YFP-β-catenin and live cell analysis. A Mann–Whitney test was performed in FRAP and FLIP experiments ( Supplementary file 1 ).

Additional files 10.7554/eLife.16748.034 Supplementary file 1. Statistical analysis performed in this study. ( a ) The statistical significance p values (t test) at each time point for the percentage of cells showing an active CCND1-MS2 gene (refers to Figure 1b ) between control and Wnt3a-treated cells. ( b-f ) Mann-Whitney test for comparison between two independent FRAP/FLIP experiments. A statistical comparison between all datasets of two individual FRAP/FLIP experiments are depicted in each plot and are illustrated as a single red circle which marks the p-value (y axis) for all intensity values measured for each time point (x axis). The top and bottom dotted lines indicate where p-value equals 0.05. ( b ) Statistically significant difference between the FRAP dynamics of YFP-β-catenin in the nucleus under Wnt3a treatment versus overexpression of YFP-β-catenin that enters the nucleus without signal, and ( c ) between the FRAP and ( d ) FLIP import and export dynamics (refers to Figure 2—figure supplement 1 ). ( e ) No statistically significant difference between YFP-β-catenin at the cell membrane between mock-treated and Wnt3a-treated cells (refers to Figure 5—figure supplement 1 ). ( f ) No statistically significant difference between YFP-β-catenin at the cell membrane between mock-treated and LiCl-treated cells (refers to Figure 5—figure supplement 1 ). DOI: http://dx.doi.org/10.7554/eLife.16748.034