Quantitative analysis of interactive behavior of mitochondria and lysosomes using structured illumination microscopy.

2.1. Materials Mito-Tracker Green (#M7514, MTG) and Lyso-Tracker Red (# L12492 , LTR) were obtained from Invitrogen (Eugene, Oregon, USA). Autophagosome dye (#NY561, DAPGreen) and mitophagy dye (#MD01-10, Kumamoto, Japan) were obtained from Dojindo Laboratories. Carbonyl cyanide 3-chlorophenylhydrazone (#045200, CCCP) was obtained from Thermo Fisherscientific (Grand Island, NY, USA). Penicillin-streptomycin (#15140163, 10,000 units/ml), fetal bovine serum (#26140079, FBS), Dulbecco’s modified Eagle’s medium (#11965118, DMEM), and other cell culture reagents were obtained from Gibco BRL (Grand Island, NY, USA). Primary and secondary antibodies used in this study were GAPDH (#5174, Cell Signaling Technology, Beverly, MA, USA), FIP200 (#12436, Cell Signaling Technology, Beverly, MA, USA), ATG13 (#13273, Cell Signaling Technology, Beverly, MA, USA), and HRP-linked anti-rabbit IgG (#7074, Cell Signaling Technology, Beverly, MA, USA). HeLa cells were a generous gift from Dr. Carolyn M. Price’s lab (University of Cincinnati). SLC-80 cells were isolated from healthy human fibroblasts by Dr. Taosheng Huang (Cincinnati Children’s Hospital, Cincinnati, OH, USA). 2.2.

Cell culture

Cells were cultured in DMEM supplemented with 10% FBS, penicillin-streptomycin (100 units/ml) in a 5% CO 2 humidified incubator at 37 °C. 2.3.

Live cell labeling

Cells were incubated with 100 nM MTG for 30 min, further co-incubated with 200 nM LTR at 37 °C for another 30 min in fresh DMEM, washed three times with fresh DMEM, and observed using a fluorescence microscopy confocal laser scanning microscopy or OMX 3D-SIM super-resolution microscope. 2.4.

Confocal laser scanning microscopy

The images were obtained using an LSM-710 confocal laser scanning microscope (Carl Zeiss, Inc.) equipped with a 63 × /1.49 numerical aperture oil-immersion objective, and they were analyzed with ZEN 2012 (Carl Zeiss, Inc.) and ImageJ software (National Institutes of Health). All fluorescence images were analyzed with ImageJ software ( https://imagej.nih.gov/ij/ ). 2.5.

OMX 3D-SIM imaging and analysis

A total of 2 × 10 5 cells were seeded on a glass-bottom microwell dish and incubated with 2 ml of DMEM medium supplemented with 10% FBS for 24 h. After treatment, the cells were washed three times with pre-warmed fresh DMEM medium, stained with 100 nM MTG for 30 min, co-incubated with 200 nM LTR at 37 °C for another 30 min, and washed with fresh DMEM three times. Finally, cells were cultured in a phenol-free medium (#1894117, Gibco, Grand Island, NY, USA) and observed under an OMX 3D-SIM super-resolution microscope (Bioptechs, Inc) equipped with an Olympus 100 × /1.49 numerical aperture oil-immersion objective lens and solid-state lasers. SIM images were analyzed with ImageJ software equipped with a fluorescence intensity measurement tool. The intensity profile along the perpendicular (white solid lines, Fig. S1 ) of mitochondria-lysosome contact (white dash lines, Fig. S1 ) was used for the M-value calculation. For co-localization, Pearson correlation coefficient (PCC, the degree of overlap between two fluorescent channels, pixel-based) was analyzed using ImageJ software equipped a colocalization analysis plugin. For more information, please refer to https://imagejdocu.tudor.lu/plugin/analysis/colocalizationfinder/start#colocalization_finder . 2.6. CRISPR/Cas9-mediated knockout of FIP200 and ATG13 in HeLa cells The pX458 plasmid (pSpCas9(BB)-2A-GFP; Addgene) was used as the cloning backbone for expressing sgFIP200 and sgATG13. Two complementary oligos for each sgRNA were denatured, annealed, and ligated into linearized pX458 vector digested by Bbsl (New England Biolabs). Empty constructs and pooled pX458-sgRNA were transiently transfected into HeLa cells, respectively, using Lipofectamine 3000 (Invitrogen). After 48 h the transfected cells were sorted based on the fluorescence of GFP (reporter) using a FACSAria cytometer (BD Biosciences). Individual sorted cells were cultured in a 96-well plate and subjected to Western blot analyses. At least three different clones were pooled for functional experiments. The sgRNA sequences targeting FIP200 and ATG13 were based on the published literature using CRISPR/Cas9 library [ 21 , 22 ]. The sgRNA sequences of FIP200 and ATG13 are listed below: sgFIP200: CAGGTGCTGGTGGTCAATGG sgATG13-1: TCACCCTAGTTATAGCAAGA sgATG13-2: CAGTCTGTTGTACACCGTGT sgATG13-3: GACTGTCCAAGTGATTGTCC 2.7.

Western-blot assay

Cells were cultured in 3.5 cm diameter plates (80–90% confluence), washed by PBS buffer, and lysed for 15 min on ice using a RIPA buffer (#C2978, Sigma, St. Louis, MO, USA) containing an anti-protease mix (#PI78415, Thermo Scientific, Waltham, MA, USA). Protein concentration was measured by BCA assay (#23225, Thermo Scientific, Waltham, MA, USA). Equal amounts of proteins were subjected to SDS-PAGE and immunoblotting as described previously [ 23 ]. 2.8.

Electron microscopy

Cells were removed from the Petri dish with a flat scraper and collected by centrifugation at 1,000g. The sample was fixed in Karnovsky, then fixed in 2% osmium tetroxide, dehydrated in a series of graded ethanol, and embedded in Araldite. The sections were cut using the LKB for ultra-thin sections and collected on a Formvar-coated grid. Sections of 70 nm thick were stained with uranyl acetate and lead citrate and evaluated in TEM (JEM 100CX II, Tokyo, Japan) with an acceleration voltage of 80 kV.

2.1. Materials Mito-Tracker Green (#M7514, MTG) and Lyso-Tracker Red (# L12492 , LTR) were obtained from Invitrogen (Eugene, Oregon, USA). Autophagosome dye (#NY561, DAPGreen) and mitophagy dye (#MD01-10, Kumamoto, Japan) were obtained from Dojindo Laboratories. Carbonyl cyanide 3-chlorophenylhydrazone (#045200, CCCP) was obtained from Thermo Fisherscientific (Grand Island, NY, USA). Penicillin-streptomycin (#15140163, 10,000 units/ml), fetal bovine serum (#26140079, FBS), Dulbecco’s modified Eagle’s medium (#11965118, DMEM), and other cell culture reagents were obtained from Gibco BRL (Grand Island, NY, USA). Primary and secondary antibodies used in this study were GAPDH (#5174, Cell Signaling Technology, Beverly, MA, USA), FIP200 (#12436, Cell Signaling Technology, Beverly, MA, USA), ATG13 (#13273, Cell Signaling Technology, Beverly, MA, USA), and HRP-linked anti-rabbit IgG (#7074, Cell Signaling Technology, Beverly, MA, USA). HeLa cells were a generous gift from Dr. Carolyn M. Price’s lab (University of Cincinnati). SLC-80 cells were isolated from healthy human fibroblasts by Dr. Taosheng Huang (Cincinnati Children’s Hospital, Cincinnati, OH, USA).

Supplementary Material 1