The neuropeptide tachykinin is essential for pheromone detection in a gustatory neural circuit.

Fly stocks

The following lines were used: Or83b-Gal4 ( Larsson et al., 2004 ); Gr-Gal4 collection including Gr68a-Gal4 2 ( Weiss et al., 2011 ); Gr68a-Gal4 1 ( Bray and Amrein, 2003 ); ppk23-Gal4 , Δppk23 , and Δppk29 ( Thistle et al., 2012 ); Voila 1 ( Balakireva et al., 1998 ); NPF-Gal4 and NPFR1-Gal4 ( Wu et al., 2003 ); c929-Gal4 ( Hewes et al., 2003 ); oeno-Gal4 and UAS - hid , stinger ( Billeter et al., 2009 ); tsh-Gal80 (kind gift of Julie Simpson); UAS-GCaMP5G ( Akerboom et al., 2012 ); ΔTK1 , ΔTK2 , and UAS-TK ( Asahina et al., 2014 ); UAS-spGFP and LexAop-spGFP ( Gordon and Scott, 2009 ); TK-Gal4 1 (#51975), TK-Gal4 2 (#51974), TK-Gal4 3 (#51973), TK-LexA (#54080), UAS - mCD8:GFP , UAS - stinger , UAS - syt.eGFP , UAS - reaper , UAS - dORKΔC , UAS - DTI , UAS-Shibire ts1 , UAS-dTrpA1 (Bloomington Stock Center, Indiana, USA); UAS-Gr68a-RNAi (13380, 13381 from VDRC, Vienna, AU) and UAS-TK-RNAi (103662 from VDRC). All other stocks used for screening are described in Table 2 . Transgenic flies ΔGr68a and ΔGr68a -rescue ( Gr68a Res ) flies were generated by ends-out homologous recombination as previously described ( Chen et al., 2011 ) using the pw25-RMCE-targeting vectors and verified by PCR using primers to the vector sequence ( Weng et al., 2009 ). Loss of the Gr68a sequence was verified by quantitative PCR. To generate Gr68a-Gal4 and UAS - GCaMP5 -expressing alleles in the mutant and rescue backgrounds, Gr68a-Gal4 2 and UAS-GCaMP5 transgenes were re-combined onto flies with the ΔGr68a or Gr68a Res background and verified by labeling with UAS-mCD8::GFP .

Chemical reagents

The chemical syntheses of (3 S ,11 Z ,19 Z )-CH503, (3 R ,11 Z ,19 Z )-CH503, ( S )-3-Acetoxy-19-octacosen-1-ol and ( R )-3-Acetoxy-11, 19-octacosadiyn-1-ol have previously been described ( Mori et al., 2010 ; Shikichi et al., 2013 ). All other solvents and reagents were obtained from Sigma–Aldrich (St. Louis, MO, USA). Courtship assay Males (5–10 days old) were isolated at the pupal stage and raised at 23°C with 60% humidity in 10 ml polypropylene vials containing 2 ml of standard cornmeal media. A decapitated virgin female target and a 5–10 days old socially naïve experimental male were placed in a courtship chamber (∅: 10 mm, height: 3 mm) and digitally recorded for 30 min. The female courtship targets were perfumed with CH503 or evaporated solvent (control) as previously described ( Yew et al., 2009 ). Briefly, six female flies were placed in 1.5-ml glass vials containing 0.25, 0.5, 1, 2, or 4 μg of ( R , Z , Z )-CH503 and vortexed three times with 20 s rest intervals. Approximately 25% of the vial contents are transferred to the flies using this method ( Billeter et al., 2009 ). A single fly from each vial was tested using direct analysis in real time mass spectrometry (DART MS; [ Yew et al., 2008 , 2009 ]) to check the abundance of the CH503 signal relative to other cuticular hydrocarbons. For the tests of CH503 volatility, a 2-layer courtship chamber was constructed with the top layer containing a male and an unperfumed decapitated virgin female and the bottom layer containing filter paper overlaid with 64 μg of ( R , Z , Z )-CH503. To prepare female fly extract, 1 or 2 flies were submerged in hexane for 10 min at room temperature, after which the solvent was removed and added to the filter paper. The courting pairs % refers to the number of trials in which courtship was observed for longer than one minute divided by the total number of trials. Behavioral assays for perfumed and solvent-perfumed animals were performed in parallel. The courting pairs % was compared between pheromone and solvent-perfumed flies bearing the identical genetic background. Statistical analysis was performed using a Fisher's exact probability test with Yates correction (VassarStats, www.vassarstats.net ). Courtship vigor and latency were calculated for the 30 min observation period and compared using a one-way ANOVA with a Tukey's post-hoc test (SPSS Statistics, IBM, USA).

Screen for receptor and neural circuits associated with CH503 detection

Behavioral screens were performed using female targets perfumed with 83 ng/fly of ( S , Z , Z )-CH503 or 333 ng/fly dose of ( R , Z , Z )-CH503. Both doses were previously established as the minimum necessary for each stereoisomer to elicit significant courtship suppression ( Mori et al., 2010 ). Transgenic flies were generated using the Gal4–UAS system to drive expression of toxin or pro-apoptotic transgenes ( UAS - Reaper , UAS - DTI , and UAS-hid , stinger ) or transgenes that interfere with synaptic transmission ( UAS - Shibire ts1 and UAS – dORKΔC ). For Gr-Gal4 lines, UAS-Reaper was used since UAS-DTI expression led to low basal courtship activity. For central circuit screening, UAS - Shibire ts1 was used to avoid developmental lethality. For Gal4 lines in which UAS - Shibir e ts1 expression led to paralysis, seizures, or low courtship activity, UAS – dORKΔC was used as a milder form of neural inhibition. Knockdown of Gr68a expression was performed using an RNAi line since the use of other transgenes resulted in larval lethality. Manipulation of neurotransmitter levels was performed using RNAi to target the respective transporters, receptors, or biosynthetic enzymes. See Table 2 for a complete list of Gal4 and UAS-RNAi lines used for screening. For experiments involving temperature-sensitive transgenes ( UAS-Shibire ts1 and UAS-dTrpA1 ), flies were placed in a humidity-controlled incubator at 29°C for 2 hr prior to the assay to activate the transgene. Courtship chambers were placed on a hotplate pre-warmed to 29°C, during which time the flies were introduced into each chamber. The chamber was placed in an incubator at 29°C and the temperature was monitored throughout the assay. Control experiments were carried out in parallel at 23°C (for assays using UAS-Shibire ts1 ) or 19°C (for assays using UAS-dTrpA1 ).

Proboscis extension reflex assay

The proboscis extension reflex (PER) assay was performed as previously described ( Lacaille et al., 2007 ; Shiraiwa and Carlson, 2007 ). Virgin 1-day-old male and female flies were starved for 36 hr in a vial containing tissue soaked with water. Flies were mounted with nail polish on the dorsal side onto glass slides and placed in a humidified Petri dish for at least 2 hr prior to the assay. Paper wicks coated in 20 μl of a test solution were used for bilateral stimulation of the tarsi of mounted flies. One leg was touched with a paper wick soaked in 4% sucrose (in distilled H 2 O, wt/vol) while the second leg was simultaneously stimulated with one of the following solutions: (i) 4% sucrose, (ii) 25–100 μg/ml ( R , Z , Z )-CH503 in hexane, (iii) 0.25–25 μg/ml ( S , Z , Z )-CH503 in hexane, and (iv) 100 mM caffeine in dH 2 O. Each substance was tested three times with a 2 min rest between stimulations. A response was counted as positive when the fly extended its proboscis for at least 2 of 3 stimulations. The response to each substance was compared to the response induced by 4% sucrose alone using a Fisher's exact probability test. The assays were carried out at the same time each day, and the experimenter was blind to the identity and concentration of stimulants tested in the assay. Immunohistochemistry Adult Drosophila brains and thoracic ganglia from 6- to 10-day-old virgin flies were dissected in phosphate buffered-saline with 0.3% Triton X-100, pH 7.2 (PBST) and fixed in ice-cold 4% paraformaldehyde for 25 min. Samples were washed three times, for 15 min each in PBST, treated in a blocking solution containing PBST and 10% normal goal serum for 30 min at room temperature, and incubated in primary antibody solution. After three washes in PBST, the tissues were incubated overnight at 4°C in secondary antibody solution. Following three washes in PBST, the brains were mounted on glass slides with Vectashield mounting medium (Vector Laboratories, Burlingame, CA). Images were acquired on a Zeiss LSM 510 Meta inverted microscope equipped with 488, 543, and 633 nm lasers. For all tissues, 132 frames with a z step size of 0.46 μm were acquired. The following secondary antibodies used were anti-chicken 488 (1:500; Jackson ImmunoResearch Laboratories, West Grove, USA), anti-rabbit Cy3 (1:500; Jackson ImmunoResearch Laboratories), anti-guinea pig Cy3 (1:500; Jackson ImmunoResearch Laboratories), anti-mouse 633 (1:500; Jackson ImmunoResearch Laboratories). Image analysis was done using ImageJ software (NIH). The following primary antibodies and dilutions were used: chicken anti-GFP (1:1000; Abcam, Cambridge, UK), mouse anti-nc82a (1:50; Developmental Studies Hybridoma Bank, Iowa City, USA), mouse anti-GFP (1:1000, for GRASP; A11120, Life Technologies, NY, USA), mouse anti-GFP (1:100, for GRASP; G6539, Sigma–Aldrich), rabbit anti-NPF (1:2000; kind gift from P Shen; [ Wu et al., 2003 ]), and guinea pig anti-TK (1:2000; kind gift from D Anderson; [ Asahina et al., 2014 ]). The Pearson's coefficient, a measure of co-localization, was calculated using Imaris software (Bitplane AG, Zurich, Switzerland).

Quantitative PCR analysis

For each biological replicate, RNA from 200 flash-frozen fly forelegs (for Gr68a experiments) or 20 flash-frozen heads (for NPF experiments) was extracted using TRIzol Reagent (Ambion, Austin, TX, USA) according to manufacturer's instructions. DNAse treatment was performed using TURBO DNA-free kit (Ambion) and cDNA was synthesized with SuperScript III (Invitrogen, Waltham, MA, USA) with an oligo-dT primer. Quantitative PCR was performed using CFX Connect Real-Time PCR System (Bio-Rad, Hercules, CA, USA) and SYBR Fast ABI Prism qPCR kit (Kapa Biosystems, Wilmington, MA, USA). See Table 3 , for primer sequences and annealing temperatures. 10.7554/eLife.06914.033 Table 3. Primers used for quantitative and semi-quantitative (semi-Q) PCR experiments DOI: http://dx.doi.org/10.7554/eLife.06914.033 Forward primer (5′–3′) Reverse primer (5′–3′) Annealing temperature (°C) Gr68a (qPCR) CCAAGGTGATACCGAGGAGGAGA TCGTGAAGAGTGCGAAAGTG 60 Gr68a (semi-Q PCR) CCAAGGTGATACCGAGGAGA CATTGGCCAGCAGATACTCA 55 CG6024 CCAAGGTGATACCGAGGAGA TCATGAAGAGTGCGAAAGTG 60 NPF GCGAAAGAACGATGTCAACAC TGTTGTCCATCTCGTGATTCC 60 rp49 CCAAGGACTTCATCCGCCACC GCGGGTGCGCTTGTTCGATCC 55 RMCE vector GTACTGACGGACACACCGAAG GGATCAACTACCGCCACCT 52 In vivo Ca 2+ imaging In vivo GCaMP imaging experiments were performed on 14- to 28-day-old adults. A live fly was immobilized on a 0.17-mm coverslip with nail polish (Sally Hansen, USA). 10 µl of PBST were placed onto the tarsal segments using a pipette, after which three pre-stimulation images were acquired for a total duration of 2.4 s. For each measurement, 117 post stimulation images were acquired for a total duration of 93.6 s immediately after the addition of 10 µl of the natural stereoisomer of CH503, ( R , Z , Z )-CH503 (final concentrations of 50 or 500 ng in PBST). Identical conditions were used for measurements using ( S , Z , Z )-CH503. No reflux flow is used in the sample preparation. Control stimulants consisted of 10 µl of solvent or an analog of CH503: ( S )-3-Acetoxy-19-octacosen-1-ol (50 ng, final concentration) or ( R )-3-Acetoxy-11, 19-octacosadiyn-1-ol (500 ng, final concentration). The analogs were previously established to be behaviorally inert ( Shikichi et al., 2013 ). Images were acquired on a spinning disk confocal microscope (Ti-E; Nikon Instruments, Melville, USA) equipped with a CSU-X1 scan head (Yokogawa Electric, Tokyo, JA) and either a digital sCMOS camera (ORCA-Flash4.0; Hamamatsu Photonics, Shizuoka, JA) or a cooled CCD camera (CoolSNAP HQ2; Photometrics, Tucson, USA) using a 60×/1.4 N.A. oil objective lens. A 491 nm laser was used to excite the GCaMP5 reporter. Four Z-slices with a thickness of 0.5 µm each were acquired every 800 ms, for a total of 120 frames. To calculate the maximum change in fluorescence signal (∆F/F), the signal density over the whole cell body was divided by the signal from an equivalent volume of an adjacent region (background). Confocal Z-stacks were analyzed using ImageJ ( Schneider et al., 2012 ). For Gr68a-Gal4 -labeled neurons, ∆F/F was calculated from single neurons. For ppk23-Gal4 -labeled neurons on the foreleg, ∆F/F was calculated from the total signal from either two adjacent cell bodies or the base of the axon projections. Due to their close proximity to each other, some individual cell bodies could not be differentiated. In some experiments, the maximum ∆F/F occurred in projections though it could not be discerned from which cell body the projection originated. For proboscis measurements, ∆F/F represents the averaged values from 14 cells (for CH503 stimulation) or 20 cells (for PBST stimulation), measured from 5–6 flies. For all measurements, the averaged, normalized response to the stimulant vs the averaged, normalized response to control solvent was compared using a Student's t -test for equal or unequal variances (Vassar Stats). Comparison of variance was determined with an F-Test (Vassar Stats). Statistical power analysis was performed using G*Power 3 ( Faul et al., 2007 ).