The transformation of enterovirus replication structures: a three-dimensional study of single- and double-membrane compartments.

Cells, antibodies, and virus. Vero E6 cells were maintained in Dulbecco’s modified Eagle’s medium (Gibco) supplemented with 10% fetal calf serum and 90 IU/ml of penicillin and streptomycin, and grown at 37°C in 5% CO 2 . The rabbit antiserum directed against the nonstructural protein 3A was described previously ( 42 ). Rabbit antisera against CVB3 3C and 3D were generously provided by C. E. Cameron (Pennsylvania State University).

Mouse monoclonal antibodies against dsRNA

(J2) and against β-actin were purchased from English & Scientific Consulting and Sigma Aldrich, respectively. The secondary antibodies Alexa Fluor 594-conjugated goat-anti-rabbit IgG and Alexa Fluor 488-conjugated goat-anti-mouse IgG were purchased from Molecular Probes. Coxsackievirus B3 (CVB3) was obtained by transfecting in vitro -transcribed RNA derived from the p53CB3/T7 plasmid, which contains the cDNA of CVB3 strain Nancy driven by a T7 RNA polymerase promoter ( 15 ). Virus titers were determined by endpoint titration analysis and expressed as 50% cell culture infectious doses (CCID 50 ). All virus infections were carried out using a multiplicity of infection (MOI) of 30 to 50. Immunofluorescence assay. Vero E6 cells grown on coverslips were infected with CVB3 for 30 minutes, after which the inoculum was removed and fresh medium was added. At various time points postinfection, cells were fixed with 4% paraformaldehyde and permeabilized with phosphate-buffered saline containing 0.1% Triton X-100. Cells were then stained with primary and secondary antibodies and analyzed with a wide-field Leica BMR microscope. Western blot analysis. CVB3-infected Vero E6 cells were collected in lysis buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 0.05% sodium dodecyl sulfate) and heated for 5 min at 95°C after addition of Laemmli sample buffer. Samples were run on a 12.5% polyacrylamide gel and transferred to a nitrocellulose membrane (Bio-Rad). Viral proteins 3A and 3D, as well as β-actin, which served as a loading control, were detected with primary antibodies and secondary IRDye anti-mouse or anti-rabbit antibodies (Li-Cor Biosciences). Imaging was done with the Odyssey system. Quantitative PCR. RNA was isolated from infected cells using a GenElute mammalian total miniprep RNA kit (Sigma). cDNA was synthesized using a TaqMan reverse transcription reagents kit (Roche), which contains random hexamers as primers. Then, a quantitative PCR (qPCR) was performed with the forward primer 5′ CGTGGGGCTACAATCAAGTT 3′ , the reverse primer 5′ TAACAGGAGCTTTGGGCATC 3′ , and the LightCycler 480 SYBR Green I master kit (Roche) for 45 cycles (5 s at 95°C, 10 s at 60°C, and 20 s at 72°C) on a LightCycler 480 (Roche). EM sample preparation. Vero E6 cells were grown on sapphire discs and infected with CVB3 for 1 h. The cells were high-pressure frozen at different time points p.i. using a Leica EM PACT2. EM sample preparation was always accompanied by an immunofluorescence assay as a control to assess the phase of infection. Freeze-substitution was performed in an automated freeze-substitution system (Leica AFS2). Multiple freeze-substitution media were tested to improve the visualization of the membranes of the virus-induced structures, which, in agreement with previous reports ( 7 , 10 ), appeared to be more difficult to contrast than other cellular membranes. In this respect, the inclusion of water and glutaraldehyde was found to be beneficial. The selected freeze-substitution medium was acetone containing 10% H 2 O, 2% osmium tetroxide, and 1% anhydrous glutaraldehyde. Samples were first maintained for 44 h at −90°C and then warmed to −20°C within 7 h, kept at −20°C for 12 h, warmed to 0°C within 2 h, and left at 0°C for 1 h. After washing with acetone at 0°C, samples were gradually infiltrated with epoxy resin LX-112 (Ladd Research) and polymerized at 60°C. Thin sections of 100 nm were counterstained with uranyl acetate and lead citrate. For the 3-D analysis, sample preparation was identical, except that 0.1% low-molecular-weight tannic acid (Electron Microscopy Sciences) was added to the freeze-substitution medium to provide additional contrast to the membranes. Samples were cut into 150- to 200-nm-thick serial sections that were placed on parallel bar copper grids (R100; Electron Microscopy Sciences) coated with Formvar and carbon. Colloidal 10-nm gold particles were layered on both sides of the sections to serve as markers for alignment. Electron microscopy. All the EM data (2-D and 3-D) were acquired in a FEI Tecnai12 BioTWIN electron microscope operating at 120 kV and equipped with an Eagle 4k cooled slow-scan charge-couple device (CCD) camera (FEI Company), using binning mode 2. Electron tomography. For each time point, multiple tilt series were collected for different cells using a dual-axis tomography holder (Fischione) and SerialEM acquisition software ( 45 ). The images, covering 130° around the specimen in 1° increments along two orthogonal axes, were recorded with a pixel size of 1.2 nm at the specimen level. For selected areas, dual-axis tilt series were acquired in three consecutive serial sections. The alignment, computation of electron tomograms, and joining of serial tomograms were performed using IMOD software ( 46 ). For visualization and presentation purposes, the tomograms were mildly denoised using a nonlinear anisotropic diffusion algorithm ( 47 ). The 3-D surface renderings were created with AMIRA (TSG Europe), drawing masks to separate the individual structures, which were then automatically thresholded.

SUPPLEMENTAL MATERIAL Movie S1 ET and 3-D modeling of early CVB3-induced membrane structures. The video illustrates the serial tomographic reconstruction presented in Fig. 3 , which encompassed a total cellular volume of around 2.3 µm by 2.3 µm by 0.6 µm. From the series of consecutive slices (2.2 nm thick) through the serial tomogram, a surface-rendered model was derived in which the clustering of parallel tubules becomes particularly apparent. DMVs are colored according to their topology, in yellow (open in a vase-like configuration) or orange (closed). ER membranes are in blue. Download Movie S1, MOV file, 17.3 MB . Movie S1, MOV file, 17.3 MB Movie S2 ET-based modeling of late CVB3-induced compartments. The animation illustrates the results presented in Fig. 4 , first through consecutive slices (2.2 nm thick) through the serial tomogram (total volume around 2.3 µm by 2.3 µm by 0.4 µm) and then with the surface-rendered model derived from it. The model highlights the relative abundance of DMVs (orange) and multilamellar structures (red) at this stage of infection. Blue, ER; light blue, mitochondria. Download Movie S2, MOV file, 12.6 MB . Movie S2, MOV file, 12.6 MB Movie S3 Intermediate structures between tubules and DMVs. The movie shows the tomograms of the structures presented in Fig. 6, plus two additional examples of open DMVs. Each frame is a 4.8-nm-thick xy slice of the corresponding structure. Download Movie S3, MOV file, 10.3 MB . Movie S3, MOV file, 10.3 MB Movie S4 Examples of enwrapping structures present in the tomograms. Reconstructions of other CVB3-induced structures that represent additional examples of enwrapping. The animation consists of consecutive xy slices (4.8 nm thick) through the tomograms. First, an open DMV enwrapping a tubule is shown. Fusion of the ends of such an open DMV could give rise to a minor proportion of DMVs present in the tomograms that contain a vesicle inside, which may have pinched off from the enwrapped tubule (second). Similarly, multiple layered cisternae enwrap different structures, such as tubules (third) or DMVs (fourth). Scale bars, 100 nm. Download Movie S4, MOV file, 7.6 MB . Movie S4, MOV file, 7.6 MB