Abstract
Plasmodium vivax and P. cynomolgi produce numerous caveola-vesicle complex (CVC) structures within the surface of the infected erythrocyte membrane. These contrast with the electron-dense knob protrusions expressed at the surface of Plasmodium falciparum-infected erythrocytes. Here we investigate the three-dimensional (3-D) structure of the CVCs and the identity of a predominantly expressed 95 kDa CVC protein. Liquid chromatography - tandem mass spectrometry analysis of immunoprecipitates by monoclonal antibodies from P. cynomolgi extracts identified this protein as a member of the Plasmodium helical interspersed subtelomeric (PHIST) superfamily with a calculated mass of 81 kDa. We named the orthologous proteins PvPHIST/CVC-81(95) and PcyPHIST/CVC-81(95) , analysed their structural features, including a PEXEL motif, repeated sequences and a C-terminal PHIST domain, and show that PHIST/CVC-81(95) is most highly expressed in trophozoites. We generated images of CVCs in 3-D using electron tomography (ET), and used immuno-ET to show PHIST/CVC-81(95) localizes to the cytoplasmic side of the CVC tubular extensions. Targeted gene disruptions were attempted in vivo. The pcyphist/cvc-81(95) gene was not disrupted, but parasites containing episomes with the tgdhfr selection cassette were retrieved by selection with pyrimethamine. This suggests that PHIST/CVC-81(95) is essential for survival of these malaria parasites.
🔬 Techniques
🔭 Microscopes
🧬 Organisms
✨ Fluorophores
🧪 Sample Preparation
🏭 Microscope Brands
🧪 Reagent Suppliers
💻 Software Details
🏛️ Research Organizations (ROR)
Affiliated research institutions:
📋 Methods
Proteomic identification of the predominant
P. vivax 95 kDa CVC protein as a member of the PHIST superfamily by detection and analysis of its homolog in P. cynomolgi iRBCs A subset of mAbs developed against mature P. vivax iRBCs were shown previously to target specifically the CVCs in P. vivax iRBC membranes and to immunoprecipitate from SDS extracts of iRBCs a predominant P. vivax antigen that migrated at 95 kDa in SDS-PAGE ( Barnwell et al. , 1990 ; Barnwell, 1986 ). Several of these mAbs were also reported at the time to cross-react in indirect immunofluorescence assays (IFA) with P. cynomolgi iRBC. P. cynomolgi iRBCs are easily generated in large quantities from rhesus monkey infections and therefore more amenable to in depth study than P. vivax attained from small New World monkey infections or clinical isolates. We set out in the current studies to use four of the mAb reagents in proteomic experiments to identify the associated gene in P. cynomolgi and further investigate the structure, location and function of this predominant protein in the context of the CVCs. To proceed, first we reconfirmed the crossreactivity of mAbs 2H12.B4, 2H8.E10, 4C12.G4, and 1H4.B6 with P. cynomolgi trophozoite iRBCs ( Fig. 1A ). The typical fluorescence pattern representative of CVCs with a dense pattern of speckling was reliably produced. These heavily dotted patterns mimic the classic spread of pink to dark red dots of Schüffner’s stippling observed throughout P. vivax and P. cynomolgi iRBCs in Giemsa-stained thin blood smears. We confirmed that all four mAbs (2H12.B4, 2H8.E10, 4C12.G4, and 1H4.B6) recognized the expected 95 kDa antigen, in SDS extracts of P. cynomolgi iRBCs by immunoblot analysis ( Fig. 1B ), and immunoprecipitated the corresponding protein and associated breakdown products. The P. cynomolgi 95 kDa protein was immunoprecipitated with each mAb, excised and processed from the SDS-PAGE gel slices and analyzed by LC-MS/MS. The resulting peptide sequences were searched against the P. vivax genome database and the gene ID: PVX_093680 (annotated as a member of the PHIST superfamily; Sargeant et al. , 2006 ) was identified with each antibody reagent. This PHIST protein, like all known members of the superfamily, is characterized by the presence of a PHIST domain, containing multiple predicted alpha helical domains and several conserved tryptophan residues. A representative immunoprecipitation result using mAb 1H4.B6 is shown in Fig. 1C , with the detection of the 95 kDa PHIST protein and a breakdown product at 37 kDa; the other major protein bands were verified by LC-MS/MS to be IgG. The MASCOT tool was used to search the P. vivax proteome database and the gene ID: PVX_093680 was identified with at least 22 spectral counts, 10 unique and no shared peptides. PVX_093680 has 2,133 nucleotides (nt) of coding sequence and is contained within two exons. The 710 amino acid protein has a calculated mass of 80.73 kDa, lower than the 95 kDa extrapolated from its relative electrophoretic mobility in SDS-PAGE gels. Such differences are not unusual for Plasmodium antigens, which depending on the amino acid composition and imposed secondary structure can (and more often than not) migrate quite different from their calculated molecular masses. To maintain the original designation of this protein as a 95 kDa antigen determined by SDS-PAGE ( Barnwell et al. , 1990 ), and recognize the calculated molecular mass of 81 kDa, we hereafter refer to this protein in P. vivax and P. cynomolgi respectively as PvPHIST/CVC-81 95 and PcyPHIST/CVC-81 95 .
Show full methods section
Proteomic identification of the predominant
P. vivax 95 kDa CVC protein as a member of the PHIST superfamily by detection and analysis of its homolog in P. cynomolgi iRBCs A subset of mAbs developed against mature P. vivax iRBCs were shown previously to target specifically the CVCs in P. vivax iRBC membranes and to immunoprecipitate from SDS extracts of iRBCs a predominant P. vivax antigen that migrated at 95 kDa in SDS-PAGE ( Barnwell et al. , 1990 ; Barnwell, 1986 ). Several of these mAbs were also reported at the time to cross-react in indirect immunofluorescence assays (IFA) with P. cynomolgi iRBC. P. cynomolgi iRBCs are easily generated in large quantities from rhesus monkey infections and therefore more amenable to in depth study than P. vivax attained from small New World monkey infections or clinical isolates. We set out in the current studies to use four of the mAb reagents in proteomic experiments to identify the associated gene in P. cynomolgi and further investigate the structure, location and function of this predominant protein in the context of the CVCs. To proceed, first we reconfirmed the crossreactivity of mAbs 2H12.B4, 2H8.E10, 4C12.G4, and 1H4.B6 with P. cynomolgi trophozoite iRBCs ( Fig. 1A ). The typical fluorescence pattern representative of CVCs with a dense pattern of speckling was reliably produced. These heavily dotted patterns mimic the classic spread of pink to dark red dots of Schüffner’s stippling observed throughout P. vivax and P. cynomolgi iRBCs in Giemsa-stained thin blood smears. We confirmed that all four mAbs (2H12.B4, 2H8.E10, 4C12.G4, and 1H4.B6) recognized the expected 95 kDa antigen, in SDS extracts of P. cynomolgi iRBCs by immunoblot analysis ( Fig. 1B ), and immunoprecipitated the corresponding protein and associated breakdown products. The P. cynomolgi 95 kDa protein was immunoprecipitated with each mAb, excised and processed from the SDS-PAGE gel slices and analyzed by LC-MS/MS. The resulting peptide sequences were searched against the P. vivax genome database and the gene ID: PVX_093680 (annotated as a member of the PHIST superfamily; Sargeant et al. , 2006 ) was identified with each antibody reagent. This PHIST protein, like all known members of the superfamily, is characterized by the presence of a PHIST domain, containing multiple predicted alpha helical domains and several conserved tryptophan residues. A representative immunoprecipitation result using mAb 1H4.B6 is shown in Fig. 1C , with the detection of the 95 kDa PHIST protein and a breakdown product at 37 kDa; the other major protein bands were verified by LC-MS/MS to be IgG. The MASCOT tool was used to search the P. vivax proteome database and the gene ID: PVX_093680 was identified with at least 22 spectral counts, 10 unique and no shared peptides. PVX_093680 has 2,133 nucleotides (nt) of coding sequence and is contained within two exons. The 710 amino acid protein has a calculated mass of 80.73 kDa, lower than the 95 kDa extrapolated from its relative electrophoretic mobility in SDS-PAGE gels. Such differences are not unusual for Plasmodium antigens, which depending on the amino acid composition and imposed secondary structure can (and more often than not) migrate quite different from their calculated molecular masses. To maintain the original designation of this protein as a 95 kDa antigen determined by SDS-PAGE ( Barnwell et al. , 1990 ), and recognize the calculated molecular mass of 81 kDa, we hereafter refer to this protein in P. vivax and P. cynomolgi respectively as PvPHIST/CVC-81 95 and PcyPHIST/CVC-81 95 .
Experimental Procedures Parasite materials
Using standard procedures, cryopreserved and reconstituted P. cynomolgi (Berok strain) ring iRBCs were inoculated as required into splenectomized Macaca mulatta (rhesus) monkeys following approved protocols from the Institutional Animal Care and Use Committee at Emory University. At an approximate 5% target parasitemia, blood was collected and passed through glass beads and cellulose CF11 columns to remove platelets and white blood cells, respectively, and then enriched for trophozoite or schizont-iRBCs by centrifugation over a 52% or 48% Percoll cushion, respectively, as described ( Barnwell et al. , 1990 ; Galinski et al. , 1992 ). P. cynomolgi genomic DNA (gDNA) was prepared from schizont-stage parasites using the QIAamp DNA Blood Extraction kit (Qiagen) following the manufacturer’s instructions. The schizonts were obtained from fresh infected blood, as described above, or from reconstituted ring-stage iRBCs that were matured to the schizont stage in short-term culture as described ( Barnwell et al. , 1999 ).
Monoclonal antibodies
Monoclonal antibodies 2H8.E10, 2H12.B4, 4C12.G4 and 1H4.B6 were among a battery of mAbs raised against P. vivax schizont and merozoite proteins and characterized as previously described ( Barnwell et al. , 1990 ; Matsumoto et al. , 1988 ; Barnwell, 1986 ). Total IgG was then purified using the Protein A MAPS affinity isolation system (BioRad) following the manufacturer’s protocol. Production of recombinant protein and antisera Pvphist/cvc-81 95 gene-specific primers PvPHIST/CVC-81 95 F (5′tat gga tcc ATG AGT CCC TGC AAC ATC) and PvPHIST/CVC-81 95 R (5′ata ctc gag TTA GAG TTT GCT GTG TTT CT) were used to amplify the full length of the gene under standard PCR conditions following the manufacturer’s protocol (Calbiochem). The amplicon was cloned into the expression vector pGEX 4T-2 (GE Healthcare) using the Bam HI and Xho I restriction sites. Positive clones were confirmed with an ABI 3100 DNA sequencer. The clones were then re-transformed into E. coli BL21 StarTM (DE3) cells (Invitrogen) for protein expression. Soluble protein was purified using Glutathione SepharoseTM 4B (GE Healthcare) slurry according to the manufacturer’s protocol. Recombinant PvPHIST-81 95 (rPvPHIST/CVC-81 95 ) was inoculated into a New Zealand White Rabbit (Covance) for production of a polyclonal antiserum, rabbit anti-rPvPHIST/CVC-81 95 .
Indirect Immunofluorescence Assays
(IFA) and western immunoblots The cross-reactivity of the mAbs raised against P. vivax was tested by IFA on air-dried, cold acetone-fixed thin films of RBCs infected with P. cynomolgi ring, trophozoite or schizont stage parasites. Following incubation with the primary antibodies, expression was detected using affinity-purified goat IgG anti-mouse conjugated to Alexa Fluor 488 (Invitrogen) as secondary antibodies. The mAbs were tested at 1:100, 1:200, 1:400 and 1:800 dilutions in phosphate-buffered saline (PBS; Lonza) containing 0.2% bovine serum albumin (BSA; Sigma). The rabbit anti-rPvPHIST/CVC-81 95 IFA reactivity was tested at dilutions of 1:100, 1:200, 1:400 and 1:800, followed by anti-rabbit antibodies conjugated to Alexa Fluor 488 (Invitrogen) at a 1:200 dilution. The parasite nuclei were visualized with DAPI, contained in ProLong Gold Antifade Reagent (Invitrogen). The slides were examined with a Zeiss Imager.Z1 or Axioskope 2 microscope with filters appropriate for the fluorescent dyes, and the images merged. For western immunoblot analyses, P. cynomolgi trophozoite extracts were electrophoretically separated on SDS-polyacrylamide gels and then transferred to a 0.2 μm nitrocellulose membrane (Schleicher & Schuell) and probed with the mAbs diluted 1:1000. Membranes were incubated with the corresponding alkaline phosphatase-conjugate as a secondary antibody (Promega) and immunoreactivity was detected by incubating with NBT/BCIP substrate (Promega).
Immunoprecipitation of P. cynomolgi extracts with monoclonal antibodies
P. cynomolgi -iRBC extracts were prepared as follows: Ice-cold 1X NET/1% NP-40 containing protease inhibitors (10 mM EDTA-Na2; 1 mM PMSF; 0.1 mM each of TPCK, TLCK, Leupeptin, Chymostatin, Antipain and 3,4-DCI; 10 μM EP-64 and 1 μM Pepstatin A; Sigma) was added to P. cynomolgi -infected erythrocyte pellet, and extracted for 30 min on ice with occasional vortexing. The samples were then transferred to pre-chilled microcentrifuge tubes and spun at 20,817 × g for 20 min at 4°C. The resulting NP-40 extracts were transferred and stored, while the pellet was extracted in 1% SDS by occasional vortexing for 10 min at room temperature. The sample was then centrifuged at 20,817 × g for 20 min at room temperature. The SDS extracts were combined with the NP-40 extracts for use in immunoprecipitations. One hundred sixty μl of rProtein G agarose suspension (Invitrogen) were incubated with 200 μg of each P. vivax mAb overnight at 4°C, rotating. Meanwhile, extracts were preclarified with rProtein G agarose overnight at 4°C, on a rotational shaker. The extracts were then separated from the preclarifying beads. Dimethyl pimelimidate (Sigma) was added to the mAb/rProtein G mix to a final concentration of 20 mM and incubated for 6 h, at 4°C, rotating. The uncoupled mAb was then removed by pulse spin, and the mixture washed with NETT (150 mM NaCl/5 mM EDTA/50 mM Tris/0.5% Triton X-100). One milliliter of the combined extract was added to the coupled mAb/rProtein G mix and incubated overnight. The beads were then washed twice with NETT, twice with NETT/0.5 M NaCl and once with NETT/0.05% SDS. The samples were resuspended in 2X SDS-PAGE loading buffer and resolved on 4–20% gradient SDS-PAGE gels (Bio-Rad).
Mass spectrometric analysis of immunoprecipitated proteins
After resolving the extracts and membrane samples on 4–15% SDS-PAGE gradient gels, the gels were stained with colloidal Coomassie blue (Imperial Protein Stain; Thermo Scientific). Gel slices were then excised, destained, dried, and processed as described ( Korir et al ., 2006 ). Briefly, the gel pieces were digested with trypsin (Sigma) and the resulting peptides extracted with trifluoroacetic acid (Sigma). The samples were then desalted and concentrated using ZipTip pipette tips (Millipore). Cleaned peptides were analyzed by reverse-phase LC-MS/MS ( Peng et al. , 2001 ) using an LTQ-Orbitrap mass spectrometer (Thermo Finnigan). A reverse database strategy using the SEQUEST algorithm was implemented to evaluate false discovery rate; the matched peptides were filtered according to matching scores to remove all false matches from the reverse database ( Peng et al. , 2003 ). Only proteins that were matched by at least two peptides were accepted to further improve the confidence of identification. The peptides were then searched against the NCBI database, with searches being limited to Plasmodium results.
Bioinformatics for peptide and gene analyses
Protein matches acquired from LC-MS/MS were searched against Plasmodium (PlasmoDB; www.plasmodb.org ) and general (National Center for Biotechnology and Information; http://www.ncbi.nlm.nih.gov/sites/entrez?db=Protein&itool=toolbar ) databases to determine the homologous genes. Signal peptide cleavage sites and transmembrane domains were predicted with SignalP V3.0 ( http://www.cbs.dtu.dk/services/SignalP/ ) and TMpred ( www.ch.embnet.org/software/TMPRED_form.html ) software, respectively. Multiple alignments of PHIST protein sequences were generated using ClustalW2 ( http://www.ebi.ac.uk/Tools/clustalw2/index.html ) or the MacVector v7.2.3 software. The GOR4 program ( http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_gor4.html ; Combet et al. , 2000 ) was used to predict secondary structure using the amino acid sequences of the PHIST family members. Polymerase Chain Reaction amplification and cloning of the pcyphist/cvc-81 95 gene Polymerase Chain Reaction (PCR) amplification of the pcyphist/cvc-81 95 gene from P. cynomolgi gDNA was performed using a combination of pvphist-81 95 and the related pkphist-105 ( Fig. 2 , S1, S2 ) gene-specific primers and the Expand High Fidelity System (Roche) kit as per the manufacturer’s protocol. PCR products were then purified using the Qiaquick purification system (Qiagen), cloned into the pCR2.1 vector (Invitrogen) and sequenced using the ABI Prism BigDye Terminator v3.0 cycle sequencing kit (Applied Biosystems). By gene walking, and the subsequent design of pcyphist/cvc-81 95 -specific primers, the first 2,200 nucleotides of the pcyphist/cvc-81 95 gene were sequenced and verified. To sequence the 3′ end of pcyphist/cvc-81 95 up to the stop codon, degenerate reverse primers were designed based on the 3′ UTR sequences of pvphist/cvc-81 95 and pkphist-105 . The primer pair PcyPHIST/CVC.2023.F (5′GAT GCA AGA GTA CAT TAT GC) and PcyPHIST/CVC.3′UTR.R (5′CAA AA(A/C) GTT CTC CTA TGA CG) amplified the sequence up to the stop codon. This result was confirmed by sequencing the entire gene using pcyphis/cvct81 95 -specific primers: PcyPHIST/CVC.1.F (5′ATG AGT CCC TGC AAC ATC), PcyPHIST/CVC.263.R (5′CTC AGA GAG ATA TGC TCA AA), PcyPHIST/CVC.566.R (5′CAT CTC CTC CTC TTG CCA), PcyPHIST/CVC.762R (5′TCA GAG GGA TCG GTA TCG), PcyPHIST/CVC.1229.R (5′CAC CTC TTC CGT GGT ATT), PcyPHIST/CVC.2023.F (5′GAT GCA AGA GTA CAT TAT GC), PcyPHIST/CVC.2160.R (5′GAG TAT TGC ATA ATG TAC TC), and PcyPHIST/CVC.2433.R (5′TAC AAT TTA CTG TGT TTC TTC).
Transfection of P. cynomolgi iRBCs Selection Cassette
A vector with a pBlueScript backbone containing a pyrimethamine selection cassette inserted into the NdeI restriction site of the multiple cloning site was kindly provided by Alan Thomas ( van der Wel et al. , 1997 ). This vector includes the following gene fragments positioned head to tail: 5′ UTR sequence of pbdhfr-ts, mutated tgdhfr-ts coding sequence, and 3′ UTR sequence of pbdhfr-ts. Its total size is 4,996 bp. Three mutations of the tgdhfr-ts coding sequence (Ser 36 Arg, Thr 83 Asn and Phe 245 Ser) required to confer resistance to pyrimethamine were confirmed by end sequencing. P. cynomolgi phist/cvc-81 95 knockout construct (pcyΔphist/cvc8195 vector) The following primer pairs were designed to amplify 600 bp from the 5′ region of pyphist/cvc-81 95 (from −555 to 45) and 554 bp from the 3′ region of the pcyphist/cvc-81 95 (from 693 to 1246): Pcyphist/cvc-81 95 3FP, ATTT CCCGGG AGAATGTATGATGAAGAATA; Pcyphist/cvc-81 95 3RP, TCCATATCAAGTCTTCCACCTCGT; Pcyphist/cvc-81 95 5FP, TTAAGAGAGCCATCGATGCC; and Pcyphist/cvc-81 95 5RP, ATTT CCCGGG ATCATAGTAGTCATGGTTAC. The Sma I site required for subsequent reactions is underlined. All amplicons were generated using the KOD polymerase (Novagen). The 5′ and 3′ fragments were ligated using the Sma I restriction site added to the reverse primer of the 5′ region and the forward primer of the 3′ region, and amplified again with the forward primer recognizing the 5′ region and reverse primer recognizing the 3′ region. The amplicon representing the combined 5′ and 3′ fragments was inserted into the Sma I site of the pUC19 vector (New England Biolabs) to make the pUC pcyphist5′/3′ construct. Ligation of the selection cassette into the pUC pcyphist/cvc5′/3′ vector required the addition of a blunt restriction enzyme site to the selection cassette. Briefly, a 24 bp adaptor carrying the Pme I /Nde I /Pme I restriction site sequence was inserted into the Eco RV restriction site of pCR2.1. The selection cassette was released from the pBS vector using Nde I and then subcloned into the Nde I site of the pCR2.1 Pme I /Nde I /Pme I sequences so that the cassette could be released by digestion with Pme I. The final vector was generated by blunt end ligation of the Pme I rel eased selection cassette into the pUC19 pcyphist/cvc5′/3′ plasmid digested with Sma I. In vivo selection. Sequential transfection experiments were carried out, with the animal experimental protocols presented here approved by Emory University’s Institutional Animal Care and Use Committee. For each experiment, a donor rhesus macaque was inoculated with ~1.5 x10 8 P. cynomolgi (Berok) ring-stage iRBCs. A blood sample was drawn when the parasitemia reached >4% with a majority of the iRBCs at the schizont stage. The infected blood was processed using standard procedures ( Barnwell et al. , 1999 ) and mature schizonts were then separated using a Percoll (Amersham) gradient of 50%, washed in RPMI and resuspended in cytomix ( Kocken et al. , 1999 ) at 1.5 × 10 9 parasites ml −1 . Electroporation was performed with a BioRad Gene pulser II (25 μF, 200 Ohms and 2.5 kV ( Kocken et al. , 1999 ; van der Wel et al. , 1997 ) with 0.4 ml of an iRBC suspension mixed with 0.4 ml of linearized plasmid DNA (0.1 mg) in a 0.4 cm cuvette at room temperature. The electroporated iRBCs were resuspended in RPMI and inoculated immediately into a recipient rhesus macaque. Parasitemias were checked daily by microscopic examination of blood smears. Once the parasitemia was rising, doses of 1 mg kg −1 of pyrimethamine (Sigma) were administered, with dosing times as noted in the results section. Once the pyrimethamine resistant parasitemia was rising to >3% infected blood was collected and cryopreserved using standard procedures. The animals were then treated with a standard curative regimen of chloroquine (15mg kg −1 IM × 3 days) to terminate the infections. Transmission electron microscopy and immuno-labeling P. cynomolgi trophozoite-iRBCs were fixed in incomplete RPMI-1640 containing 2% paraformaldehyde (PFA) and then permeabilized with EqtII ( Anderluh et al. , 1996 ) as previously described (Jackson et al. , 2007, Hanssen et al., 2008 ). The samples were refixed in PBS containing 2% paraformaldehyde, blocked with 3% BSA in PBS and then incubated with rabbit anti-rPvPHIST-81 95 as a primary antibody in PBS/3% BSA. After washing, the cells were incubated with 6 nm gold-conjugated Protein A (Aurion) according to the manufacturer’s instructions, washed again, and then fixed with 1% glutaraldehyde/0.5% PFA/0.1 M cacodylate buffer overnight. The samples were then embedded in 3% agarose and rinsed with 0.175 M cacodylate buffer. After post-fixation with 1% osmium tetroxide, the cells were stained ‘en-bloc’ with 1% uranyl acetate, and then serially dehydrated and embedded in LR White resin. The samples were sectioned to 70 nm thickness and after staining with lead citrate and uranyl acetate, observed at 120kV on a 2010HC (Jeol, Japan) transmission electron microscope (at La Trobe University EM Facility, Melbourne).
Electron tomography
Tomography was performed as described previously ( Hanssen et al. , 2008 ). 200–300 nm sections were cut and collected on a grid and then incubated with fiducial gold particles. The sections were then contrasted with lead citrate and uranyl acetate and observed on a tilt series from −69 degrees to 69 degrees at every 1.5 degrees between captured images for the first axis and every 3 degrees between captured images for the second axis. Data were acquired at an accelerating voltage of 200 kV using a Tecnai G2 TF30 transmission electron microscope (FEI, The Netherlands) at the Bio21 Institute electron microscopy facility (Melbourne). The tilt images were aligned and tomograms generated and rendered using the IMOD package ( Kremer et al. , 1996 ). Nucleotide sequence accession number The genomic sequence of pcyphist-81 95 was submitted to the GenBank database under accession number JN636815 .
Parasite materials Using standard procedures, cryopreserved and reconstituted P. cynomolgi (Berok strain) ring iRBCs were inoculated as required into splenectomized Macaca mulatta (rhesus) monkeys following approved protocols from the Institutional Animal Care and Use Committee at Emory University. At an approximate 5% target parasitemia, blood was collected and passed through glass beads and cellulose CF11 columns to remove platelets and white blood cells, respectively, and then enriched for trophozoite or schizont-iRBCs by centrifugation over a 52% or 48% Percoll cushion, respectively, as described ( Barnwell et al. , 1990 ; Galinski et al. , 1992 ). P. cynomolgi genomic DNA (gDNA) was prepared from schizont-stage parasites using the QIAamp DNA Blood Extraction kit (Qiagen) following the manufacturer’s instructions. The schizonts were obtained from fresh infected blood, as described above, or from reconstituted ring-stage iRBCs that were matured to the schizont stage in short-term culture as described ( Barnwell et al. , 1999 ).
Supplementary Material Supp Fig S1-S4 Supp Video S1 Supp Video S2 Supp Video S3 Supp Video S4
📊 Figures
Fig. 1
The predominant 95 kDa CVC protein is a member of the PHIST protein superfamily. A. Air-dried, acetone-fixed smears of P. cynomolg i trophozoite-iRBCs incubated with the nuclear DAPI stain (blue) and ...
Fig. 2
Protein structure and sequence identity of PcyPHIST/CVC-81 95 and its homologs. A. The schematic represents the PvPHIST/CVC-81 95 , PcyPHIST/CVC-81 95 , PkPHIST-105 and PfPHIST-147 proteins, showing t...
Fig. 3
PcyPHIST/CVC-81 95 is expressed in the ring, trophozoite and schizont stages of development. A. IFA tests. Air dried and acetone-fixed smears of ring, trophozoite and schizont-stage P. cynomolgi -iRBC...
Fig 4
Transmission EM of intact and permeabilized P. cynomolgi iRBCs. A. An intact iRBC showing one CVC at the surface (arrow); note the presence of a mitochondrion (m). B. An EqtII permeabilized iRBC secti...
Fig 5
Electron tomography of CVCs in a P. cynomolgi trophozoite - iRBC. Virtual sections through an approximately 200 nm thick tomogram are presented. Each image represents a thickness of 2.7 nm and the spa...
Fig. 6
Immuno-electron tomography of a CVC in a P. cynomolgi trophozoite-iRBC. Au2013H. Equinatoxin II permeabilised P. cynomolgi trophozoite-iRBCs were labeled with two different antibodies (Au2013D, mAb 4C...
Figure images are served from the NIH/NLM PubMed Central Open Access Subset or Europe PMC; copyright remains with the publishers and authors.
💬 Discussion
0 commentsNo comments yet. Be the first to start a discussion!
Leave a Comment