CaMKII Autophosphorylation Is Necessary for Optimal Integration of Ca2+ Signals during LTP Induction, but Not Maintenance.

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Ryohei Yasuda ( ryohei.yasuda@mpfi.org ).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

All experimental protocols were approved by Max Planck Florida Institute IACUC, Duke University Medical Center or National Institutes of Natural Sciences and meet the guidelines of the National Institutes of Health guide for the Care and Use of Laboratory Animals.

Animals

Mice from BL6/C57 strain (purchased from Charles River Laboratories, both males and females) were used as wild-type group in 2pFLIM measurements. Camk2a T286A knock-in mice were from Dr. KP. Giese ( Giese et al., 1998 ). CaMKIIα conditional knock-out mice ( Camk2a fl/fl , strain name: C57BL/6- Camk2a tm1Vyb ; deposited by Dr. S. Tonegawa) that carry a floxed exon 2 allele were from the Jackson Laboratory ( Hinds et al., 2003 ). All experimental animals were bred in-house under the animal care and guidelines of Duke University Medical Center and Max Planck Florida Institute for Neuroscience. Hippocampal Slices Organotypic cultured hippocampal slices were prepared from postnatal 4–7 day mice (both mail and females (see a detailed protocol at ( Stoppini et al., 1991 )). Briefly, tissue slices were plated on cell culture inserts (hydrophilic PTFE, 0.4 µm, Millipore) and maintained in tissue medium (minimum essential medium eagle (MEM) 8.4 mg/ml, horse serum 20%, L-glutamine 1 mM, CaCl 2 1 mM, MgSO 4 2 mM, D-glucose 12.9 mM, NaHCO 3 5.2 mM, HEPES 30 mM, insulin 1 µg/ml, ascorbic acid 0.075%) at 37°C supplemented with 5% CO 2 until experiments (DIV 12–19). Hippocampal slices were biolistically transfected with plasmids at DIV 5–10 (12 mg gold particle, size: 1 µm, 30 µg plasmid). Acute slices were prepared from postnatal 30–40 day Camk2a T286A mice and littermates. Preparation of slice cultures was in accordance with the animal care and guidelines of Duke University Medical Center and Max Planck Florida Institute for Neuroscience. Acute Slices Mice (both male and females) were sedated by isoflurane inhalation, and perfused intracardially with a chilled choline chloride solution. Brain was removed and placed in the same choline chloride solution composed of 124 mM Choline Chloride, 2.5 mM KCl, 26 mM NaHCO 3 , 3.3 mM MgCl 2 , 1.2 mM NaH 2 PO 4 , 10 mM glucose and 0.5 mM CaCl 2 , pH 7.4 equilibrated with 95% O2/5% CO 2 . Coronal slices (250 µm) were prepared from Camk2a T286A mice and wild-type littermates age between P30-P40.

Primary Neuronal Culture

Neocortex dissected from 4 newborn mice (postnatal day 0; Both males and females) were triturated and plated into 35 mm dishes coated with 50 µg/ml PLL (Sigma) in culture medium composed of basal medium Eagle (BME) supplemented with 10% heat-inactivated fetal bovine serum (Invitrogen), 35 mM glucose (Sigma), 1 mM Glutamax (Sigma), 100 U/ml penicillin (Sigma), and 0.1 mg/ml streptomycin (Sigma). Proliferation of non-neuronal cells was inhibited by Cytosine arabinoside (2.5 µM) treatment on the second day after plating.

Method Details Plasmids

Molecular cloning and mutations were carried out using QuikChange site-directed mutagenesis kit (Agilent Technologies) and InFusion cloning kit (Clontech). Expression of Camuiα was under pCAG promoter. Camuiα (dimVenus-CaMKII-mEGFP or Green-Camuiα) was described previously ( Lee et al, 2009 ). We used dimVenus (Venus A208K, T145W ) instead of sREACh, which has slightly better characteristics as FRET donor ( Murakoshi et al., 2008 ), since this version has been already extensively characterized ( Lee et al., 2009 ). shRNA against CaMKIIβ ( Mus musculus ) were purchased from GE-Dharmacon. pGIPZ Camk2b shRNA (TCAGAGAGGAACTTCCCAG; V2LMM2804) were used to knock-down Camk2b . pGIPZ non-silencing shRNA (CTTACTCTCGCCCAAGCGAGAG) were used as a control. pCMV-CaMKIIβ ( Rattus ) is from Dr. Hayashi ( Okamoto et al, 2007 ).

Microscope

Fluorescent lifetime of Camuiα was measured by a home-built two-photon fluorescence lifetime imaging microscopy (2pFLIM). Camuiα was excited with a Ti:Sapphire laser tuned at 920 nm (Coherent, Chameleon) with laser power measured under the water immersion objective (Olympus, NA = 0.9, 60x) in the range of 1–1.5 mW, see detailed information at ( Murakoshi et al., 2008 ; Yasuda et al., 2006 ). A second Ti:Sapphire laser at 720 nm (laser power measured under the objective: 2.5–3 mW), pulse duration of 4–6 ms was used to photolysis MNI-caged L-glutamate.

CaMKII activity imaging

Hippocampal slices were bathed in artificial cerebrospinal fluid (ACSF) bubbled with carbogen (95% O 2 / 5% CO 2 ) during the image recordings. Final ion concentrations (in mM) in imaging solution: NaCl 127, NaHCO 3 25, D-glucose 25, KCl 2.5, NaH 2 PO 4 1.25, supplemented with CaCl 2 4, MNI-caged L-glutamate (Tocris) 4, TTX 0.001, Trolox (Sigma) 1. Between DIV 12–19, we imaged individual transfected CA1 pyramidal neurons. Dendritic spines on the secondary and tertiary apical dendrites were used for imaging. Images were acquired by a home-built 2pFLIM microscope controlled by custom software (MatLab). Experiments were performed at 25 ± 0.5°C or 34–35 °C as indicated. The temperature was controlled with a control syringe heater and an inline solution heater (TC344C, SW-10/6 and SH-27B, Warner Instruments). Recordings were performed with 32×32 pixels (pixel size: 12.3 ± 1.72 pixel/µm) at 128 ms/frame (7.8 Hz).

2pFLIM data analysis

Fluorescence lifetime of mEGFP in Camuiα is affected by the FRET efficiency. Fluorescence lifetime of mEGFP in Camuiα has at least 3 populations: closed conformation (basal), open conformation (active), and mEGFP (donor) with unfolded dimVenus (acceptor). The third population can be regarded as a constant component throughout the measurement. Since Camuiα is a monomeric FRET pair sensor (1:1 ratio of mEGFP: dimVenus), the change of mean fluorescence lifetime of Camuiα (τ m ) reflects the change of FRET efficiency and thus the conformation change of Camuiα. The mean fluorescence lifetime of Camuiα (τ m ) was derived from the mean photon arrival time 〈 t 〉 as follows: τ m = 〈 t 〉 − t 0 = ∫ dt ⋅ tF ( t ) ∫ dt ⋅ F ( t ) − t 0 , where F ( t ) is the fluorescence lifetime decay curve and t 0 is the instrumental time offset. We estimated t 0 by fitting to the fluorescence decay curve summing all pixels in all frames over a whole image session (typically 1024 frames) with a double exponential function convolved with the Gaussian pulse response function: F ( t ) = F 0 ∑ i = 1 , 2 P i H ( t , t 0 , τ i , τ G ) , where P i is the population of fluorophore (mEGFP) with the fluorescence lifetime of τ i , respectively, and H ( t ) is the fluorescence lifetime curve with a single exponential function convolved with the Gaussian pulse response function: H ( t , t 0 , τ i , τ G ) = 1 2 exp ( τ G 2 2 τ i 2 − t − t 0 τ i ) erfc ( τ G 2 − τ i ( t − t 0 ) 2 τ i τ G ) − t 0 ′ , in which τ G is the width of the Guassian pulse response function, F 0 is the peak fluorescence before convolution, t 0 ′ is the instrumental time offset measured by the fitting, and erfc is the error function. Since the mean fluorescence lifetime can be obtained from the fitting as τ m = ∑ i P i τ i 2 ∑ i P i τ i t 0 can be calculated as: t 0 = 〈 t 〉 − ∑ i P i τ i 2 ∑ i P i τ i In our typical setting, t0 is ~ 1–2 ns. For Green-Camuiα, the parameters are typically, τ1 ~ 1.9–2.1 ns, τ2 ~ 0.4–0.6 ns, τG ~ 0.15 ns and P1 ~ 0.4–0.5 (P2 = 1 − P1). A change in the population (P1 and P2) by ~ 10% causes a change in the mean fluorescence lifetime (τm) by ~ 0.1 ns.. A change in the population ( P 1 and P 2 ) by ~ 10% causes a change in the mean fluorescence lifetime (τ m ) by ~ 0.1 ns. It should be noted that changes in the fluorescence lifetime are independent of the fitting. Measurements of structural plasticity Two-photon laser scanning microscopy (2pLSM) was used to quantify the spine volume change during glutamate uncaging of sLTP ( Matsuzaki et al., 2004 ). When the experiments were performed in Camk2a T286A knock-in mice, hippocampal slices were cultured from Camk2a T286A/T286A (homozygous), Camk2a T286A/WT (heterozygous), and wild-type littermates. Hippocampal slices were biolistically transfected with mEGFP (12 mg gold particle, size: 1 µm, 30 µg plasmid) at DIV 7–10. Transfected CA1 neurons were imaged between DIV 12–17. For the experiments performed in Camk2a fl/fl mice, the transfected plasmids are as follows: 1) conditional knock-out group: co-transfected with tdTomato labeled Cre recombinase (pCAG-tdTM-cre, 25 µg) and mEGFP (pCAG-mEGFP, 20 µg); 2) control group: co-transfected with tdTomato (pCAG-tdTM, 25 µg) and pCAG-mEGFP (20 µg). Transfected CA1 neurons with Cre positive cells were excited with Ti:Sapphire laser at 920 nm (Coherent, Chameleon) with laser power measured under the objective (Olympus, NA = 0.9, 60x) in the range of 1–1.5 mW. Green-channel fluorescence collected from PMT (photoelectron multiplier tubes) placed after the 510 nm/70 nm (bandwidth) wavelength filters were used for spine volume change analysis.

Calcium imaging

We performed whole-cell patch clamp to hippocampal cultured neurons from Camk2a T286A mice and wild-type littermates with the pipette containing Fluo-4FF (Ca 2+ indicator) and Alexa-594 in Potassium Gluconate internal solution (in mM: K gluconate 130, Na phosphocreatine 10, MgCl2 4, Na 2 ATP 4, MgGTP 0.3, L- Ascorbic acid 3, HEPES 10, pH 7.4, 310 mosm). 2pLSM and Ti:Sapphire laser at 920 nm (Coherent, Chameleon) was used to simultaneously excite the two fluorescent dyes and thus the fluorescence from Fluo-4FF can be used to quantify the [Ca 2+ ] transients during glutamate uncaging of sLTP. Images were acquired every 64 ms.

AAV injection

E14.5/15.5 timed-pregnant Camk2a fl/fl mice were anesthetized with ~2% isoflurane and administered 0.1 mg buprenorphine SR (ZooPharm) for analgesia. The uterine horns were exposed through an abdominal incision and the right lateral ventricle of each embryo was injected with approximately 1–2 µl of AAV solution. Half of the embryos were injected with AAV1.CAG.EGFP, and half were injected with AAV1.CAG.Flex.tdTomato/ AAV1.hSyn.Cre (all from U Penn vector core).

Electrophysiology

Slices were maintained in a submerged chamber at 32 °C for 1h and then at room temperature in oxygenated ACSF. Whole cell recordings and LTP protocol: CA1 pyramidal neurons were visualized using oblique illumination. Whole cell recordings were performed using a patch-clamp amplifier (Multiclamp 700B, Molecular Devices). Patch pipettes (3–6 ΩM) were filled with a K Gluconate solution (130 mM K gluconate, 10 mM Na phosphocreatine, 4 mM MgCl 2 , 4 mM Na 2 ATP, 0.3 mM MgGTP, 3 mM L-Ascorbic acid, 10 mM HEPES, pH 7.4, 310 mosm). Series resistances (10 to 40 MΩ) and input resistances (100 to 300 MΩ) were monitored throughout the experiment using negative voltage steps (-5 mV, 50 ms). The membrane potential was held at −70 mV. Experiments were performed at room temperature and slices were perfused with oxygenated ACSF (127 mM NaCl, 2.5 mM KCl, 10 mM glucose, 10 mM NaHCO 3 , 1.25 mM NaH 2 PO 4 , 2 mM MgCl 2 , 2 mM CaCl 2 , 0.1 mM Picrotoxin). Excitatory postsynaptic currents (EPSCs) were evoked by extracellular stimulation of the Schaffer collateral fibers using a concentric bipolar stimulating electrode (World Precision Instruments) at 0.03 Hz. LTP was induced by pairing synaptic stimulation (2 Hz for 120 pulses, or 40 Hz for 600 pulses at the end of the depolarization) with a postsynaptic depolarization to 0 mV (60 s). EPSP potentiation was assessed for 50–60 min after LTP condition stimulation. For the APV experiments, APV (50 µM) was applied 10 min before recording. All data was analyzed with an in-house program written in MatLab.

Validation of shRNA

Dissociated cortical neuron cultures were infected with GIPZ lentiviral CAMKIIβ shRNA (1 µl/ml) or GIPZ lentiviral scramble shRNA (titer: 1.5×1013 genome copies/µl; Dharmacon) at DIV 6. On DIV 14–16, neurons were washed with PBS and immediately extracted with SDS buffer. Samples were separated on 4–20% acrylamide gel (Mini-PROTEAN TGX precast gels, Bio-Rad), then transferred onto 0.45 µm pore size PVDF membranes (Millipore) using semidry immunoblotting (transfer buffer containing 25 mM Tris, 200 mM glycine and 20% methanol). Membranes were blocked with 5% nonfat milk in TBS-T (Tris Buffered Saline with 0.1% Tween-20) for 1 hour at room temperature, then incubated overnight at 4°C with primary antibodies diluted in 5% BSA in TBS-T. We used the following commercially available antibodies: mouse anti-CAMKIIβ (1:200; LS-B5767; LSBio), and mouse anti-β-actin (1:2000; Sigma). Membranes were washed 3 times for 15 minutes in TBS-T, followed by incubation for 1 hour at room temperature with HRP-conjugated rabbit anti-mouse secondary antibody (Bio-Rad), diluted 1:2000 in 5% nonfat milk in TBS-T. Membranes were washed 3 times for 15 minutes in TBS-T, then incubated with Pierce ECL Plus western blotting substrate (for CAMKIIβ) or Pierce ECL western blotting substrate (for β-actin) to detect western blotted proteins. We used the Image Quant LAS4000 Imaging System (GE Healthcare) to visualize protein bands. Image J software was used to quantify endogenous CAMKIIβ levels normalized to β-actin to ensure equal loading. The Quantification and Statistical Analysis Error bars shown in the figures represent standard error of the mean (s.e.m). One-way ANOVA analysis with post hoc Bonferroni test are used to compare different conditions (α = 0.05). n indicates the number of spines/neurons for spine imaging results and the number of cells for electrophysiology results. Asterisks denote the statistical significance (*p < 0.05). s.e.m of time constants is obtained by bootstrapping.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

All experimental protocols were approved by Max Planck Florida Institute IACUC, Duke University Medical Center or National Institutes of Natural Sciences and meet the guidelines of the National Institutes of Health guide for the Care and Use of Laboratory Animals.

Animals

Mice from BL6/C57 strain (purchased from Charles River Laboratories, both males and females) were used as wild-type group in 2pFLIM measurements. Camk2a T286A knock-in mice were from Dr. KP. Giese ( Giese et al., 1998 ). CaMKIIα conditional knock-out mice ( Camk2a fl/fl , strain name: C57BL/6- Camk2a tm1Vyb ; deposited by Dr. S. Tonegawa) that carry a floxed exon 2 allele were from the Jackson Laboratory ( Hinds et al., 2003 ). All experimental animals were bred in-house under the animal care and guidelines of Duke University Medical Center and Max Planck Florida Institute for Neuroscience. Hippocampal Slices Organotypic cultured hippocampal slices were prepared from postnatal 4–7 day mice (both mail and females (see a detailed protocol at ( Stoppini et al., 1991 )). Briefly, tissue slices were plated on cell culture inserts (hydrophilic PTFE, 0.4 µm, Millipore) and maintained in tissue medium (minimum essential medium eagle (MEM) 8.4 mg/ml, horse serum 20%, L-glutamine 1 mM, CaCl 2 1 mM, MgSO 4 2 mM, D-glucose 12.9 mM, NaHCO 3 5.2 mM, HEPES 30 mM, insulin 1 µg/ml, ascorbic acid 0.075%) at 37°C supplemented with 5% CO 2 until experiments (DIV 12–19). Hippocampal slices were biolistically transfected with plasmids at DIV 5–10 (12 mg gold particle, size: 1 µm, 30 µg plasmid). Acute slices were prepared from postnatal 30–40 day Camk2a T286A mice and littermates. Preparation of slice cultures was in accordance with the animal care and guidelines of Duke University Medical Center and Max Planck Florida Institute for Neuroscience. Acute Slices Mice (both male and females) were sedated by isoflurane inhalation, and perfused intracardially with a chilled choline chloride solution. Brain was removed and placed in the same choline chloride solution composed of 124 mM Choline Chloride, 2.5 mM KCl, 26 mM NaHCO 3 , 3.3 mM MgCl 2 , 1.2 mM NaH 2 PO 4 , 10 mM glucose and 0.5 mM CaCl 2 , pH 7.4 equilibrated with 95% O2/5% CO 2 . Coronal slices (250 µm) were prepared from Camk2a T286A mice and wild-type littermates age between P30-P40.

Primary Neuronal Culture

Neocortex dissected from 4 newborn mice (postnatal day 0; Both males and females) were triturated and plated into 35 mm dishes coated with 50 µg/ml PLL (Sigma) in culture medium composed of basal medium Eagle (BME) supplemented with 10% heat-inactivated fetal bovine serum (Invitrogen), 35 mM glucose (Sigma), 1 mM Glutamax (Sigma), 100 U/ml penicillin (Sigma), and 0.1 mg/ml streptomycin (Sigma). Proliferation of non-neuronal cells was inhibited by Cytosine arabinoside (2.5 µM) treatment on the second day after plating.

Method Details Plasmids

Molecular cloning and mutations were carried out using QuikChange site-directed mutagenesis kit (Agilent Technologies) and InFusion cloning kit (Clontech). Expression of Camuiα was under pCAG promoter. Camuiα (dimVenus-CaMKII-mEGFP or Green-Camuiα) was described previously ( Lee et al, 2009 ). We used dimVenus (Venus A208K, T145W ) instead of sREACh, which has slightly better characteristics as FRET donor ( Murakoshi et al., 2008 ), since this version has been already extensively characterized ( Lee et al., 2009 ). shRNA against CaMKIIβ ( Mus musculus ) were purchased from GE-Dharmacon. pGIPZ Camk2b shRNA (TCAGAGAGGAACTTCCCAG; V2LMM2804) were used to knock-down Camk2b . pGIPZ non-silencing shRNA (CTTACTCTCGCCCAAGCGAGAG) were used as a control. pCMV-CaMKIIβ ( Rattus ) is from Dr. Hayashi ( Okamoto et al, 2007 ).

Microscope

Fluorescent lifetime of Camuiα was measured by a home-built two-photon fluorescence lifetime imaging microscopy (2pFLIM). Camuiα was excited with a Ti:Sapphire laser tuned at 920 nm (Coherent, Chameleon) with laser power measured under the water immersion objective (Olympus, NA = 0.9, 60x) in the range of 1–1.5 mW, see detailed information at ( Murakoshi et al., 2008 ; Yasuda et al., 2006 ). A second Ti:Sapphire laser at 720 nm (laser power measured under the objective: 2.5–3 mW), pulse duration of 4–6 ms was used to photolysis MNI-caged L-glutamate.

CaMKII activity imaging

Hippocampal slices were bathed in artificial cerebrospinal fluid (ACSF) bubbled with carbogen (95% O 2 / 5% CO 2 ) during the image recordings. Final ion concentrations (in mM) in imaging solution: NaCl 127, NaHCO 3 25, D-glucose 25, KCl 2.5, NaH 2 PO 4 1.25, supplemented with CaCl 2 4, MNI-caged L-glutamate (Tocris) 4, TTX 0.001, Trolox (Sigma) 1. Between DIV 12–19, we imaged individual transfected CA1 pyramidal neurons. Dendritic spines on the secondary and tertiary apical dendrites were used for imaging. Images were acquired by a home-built 2pFLIM microscope controlled by custom software (MatLab). Experiments were performed at 25 ± 0.5°C or 34–35 °C as indicated. The temperature was controlled with a control syringe heater and an inline solution heater (TC344C, SW-10/6 and SH-27B, Warner Instruments). Recordings were performed with 32×32 pixels (pixel size: 12.3 ± 1.72 pixel/µm) at 128 ms/frame (7.8 Hz).

2pFLIM data analysis

Fluorescence lifetime of mEGFP in Camuiα is affected by the FRET efficiency. Fluorescence lifetime of mEGFP in Camuiα has at least 3 populations: closed conformation (basal), open conformation (active), and mEGFP (donor) with unfolded dimVenus (acceptor). The third population can be regarded as a constant component throughout the measurement. Since Camuiα is a monomeric FRET pair sensor (1:1 ratio of mEGFP: dimVenus), the change of mean fluorescence lifetime of Camuiα (τ m ) reflects the change of FRET efficiency and thus the conformation change of Camuiα. The mean fluorescence lifetime of Camuiα (τ m ) was derived from the mean photon arrival time 〈 t 〉 as follows: τ m = 〈 t 〉 − t 0 = ∫ dt ⋅ tF ( t ) ∫ dt ⋅ F ( t ) − t 0 , where F ( t ) is the fluorescence lifetime decay curve and t 0 is the instrumental time offset. We estimated t 0 by fitting to the fluorescence decay curve summing all pixels in all frames over a whole image session (typically 1024 frames) with a double exponential function convolved with the Gaussian pulse response function: F ( t ) = F 0 ∑ i = 1 , 2 P i H ( t , t 0 , τ i , τ G ) , where P i is the population of fluorophore (mEGFP) with the fluorescence lifetime of τ i , respectively, and H ( t ) is the fluorescence lifetime curve with a single exponential function convolved with the Gaussian pulse response function: H ( t , t 0 , τ i , τ G ) = 1 2 exp ( τ G 2 2 τ i 2 − t − t 0 τ i ) erfc ( τ G 2 − τ i ( t − t 0 ) 2 τ i τ G ) − t 0 ′ , in which τ G is the width of the Guassian pulse response function, F 0 is the peak fluorescence before convolution, t 0 ′ is the instrumental time offset measured by the fitting, and erfc is the error function. Since the mean fluorescence lifetime can be obtained from the fitting as τ m = ∑ i P i τ i 2 ∑ i P i τ i t 0 can be calculated as: t 0 = 〈 t 〉 − ∑ i P i τ i 2 ∑ i P i τ i In our typical setting, t0 is ~ 1–2 ns. For Green-Camuiα, the parameters are typically, τ1 ~ 1.9–2.1 ns, τ2 ~ 0.4–0.6 ns, τG ~ 0.15 ns and P1 ~ 0.4–0.5 (P2 = 1 − P1). A change in the population (P1 and P2) by ~ 10% causes a change in the mean fluorescence lifetime (τm) by ~ 0.1 ns.. A change in the population ( P 1 and P 2 ) by ~ 10% causes a change in the mean fluorescence lifetime (τ m ) by ~ 0.1 ns. It should be noted that changes in the fluorescence lifetime are independent of the fitting. Measurements of structural plasticity Two-photon laser scanning microscopy (2pLSM) was used to quantify the spine volume change during glutamate uncaging of sLTP ( Matsuzaki et al., 2004 ). When the experiments were performed in Camk2a T286A knock-in mice, hippocampal slices were cultured from Camk2a T286A/T286A (homozygous), Camk2a T286A/WT (heterozygous), and wild-type littermates. Hippocampal slices were biolistically transfected with mEGFP (12 mg gold particle, size: 1 µm, 30 µg plasmid) at DIV 7–10. Transfected CA1 neurons were imaged between DIV 12–17. For the experiments performed in Camk2a fl/fl mice, the transfected plasmids are as follows: 1) conditional knock-out group: co-transfected with tdTomato labeled Cre recombinase (pCAG-tdTM-cre, 25 µg) and mEGFP (pCAG-mEGFP, 20 µg); 2) control group: co-transfected with tdTomato (pCAG-tdTM, 25 µg) and pCAG-mEGFP (20 µg). Transfected CA1 neurons with Cre positive cells were excited with Ti:Sapphire laser at 920 nm (Coherent, Chameleon) with laser power measured under the objective (Olympus, NA = 0.9, 60x) in the range of 1–1.5 mW. Green-channel fluorescence collected from PMT (photoelectron multiplier tubes) placed after the 510 nm/70 nm (bandwidth) wavelength filters were used for spine volume change analysis.

Calcium imaging

We performed whole-cell patch clamp to hippocampal cultured neurons from Camk2a T286A mice and wild-type littermates with the pipette containing Fluo-4FF (Ca 2+ indicator) and Alexa-594 in Potassium Gluconate internal solution (in mM: K gluconate 130, Na phosphocreatine 10, MgCl2 4, Na 2 ATP 4, MgGTP 0.3, L- Ascorbic acid 3, HEPES 10, pH 7.4, 310 mosm). 2pLSM and Ti:Sapphire laser at 920 nm (Coherent, Chameleon) was used to simultaneously excite the two fluorescent dyes and thus the fluorescence from Fluo-4FF can be used to quantify the [Ca 2+ ] transients during glutamate uncaging of sLTP. Images were acquired every 64 ms.

AAV injection

E14.5/15.5 timed-pregnant Camk2a fl/fl mice were anesthetized with ~2% isoflurane and administered 0.1 mg buprenorphine SR (ZooPharm) for analgesia. The uterine horns were exposed through an abdominal incision and the right lateral ventricle of each embryo was injected with approximately 1–2 µl of AAV solution. Half of the embryos were injected with AAV1.CAG.EGFP, and half were injected with AAV1.CAG.Flex.tdTomato/ AAV1.hSyn.Cre (all from U Penn vector core).

Electrophysiology

Slices were maintained in a submerged chamber at 32 °C for 1h and then at room temperature in oxygenated ACSF. Whole cell recordings and LTP protocol: CA1 pyramidal neurons were visualized using oblique illumination. Whole cell recordings were performed using a patch-clamp amplifier (Multiclamp 700B, Molecular Devices). Patch pipettes (3–6 ΩM) were filled with a K Gluconate solution (130 mM K gluconate, 10 mM Na phosphocreatine, 4 mM MgCl 2 , 4 mM Na 2 ATP, 0.3 mM MgGTP, 3 mM L-Ascorbic acid, 10 mM HEPES, pH 7.4, 310 mosm). Series resistances (10 to 40 MΩ) and input resistances (100 to 300 MΩ) were monitored throughout the experiment using negative voltage steps (-5 mV, 50 ms). The membrane potential was held at −70 mV. Experiments were performed at room temperature and slices were perfused with oxygenated ACSF (127 mM NaCl, 2.5 mM KCl, 10 mM glucose, 10 mM NaHCO 3 , 1.25 mM NaH 2 PO 4 , 2 mM MgCl 2 , 2 mM CaCl 2 , 0.1 mM Picrotoxin). Excitatory postsynaptic currents (EPSCs) were evoked by extracellular stimulation of the Schaffer collateral fibers using a concentric bipolar stimulating electrode (World Precision Instruments) at 0.03 Hz. LTP was induced by pairing synaptic stimulation (2 Hz for 120 pulses, or 40 Hz for 600 pulses at the end of the depolarization) with a postsynaptic depolarization to 0 mV (60 s). EPSP potentiation was assessed for 50–60 min after LTP condition stimulation. For the APV experiments, APV (50 µM) was applied 10 min before recording. All data was analyzed with an in-house program written in MatLab.

Validation of shRNA

Dissociated cortical neuron cultures were infected with GIPZ lentiviral CAMKIIβ shRNA (1 µl/ml) or GIPZ lentiviral scramble shRNA (titer: 1.5×1013 genome copies/µl; Dharmacon) at DIV 6. On DIV 14–16, neurons were washed with PBS and immediately extracted with SDS buffer. Samples were separated on 4–20% acrylamide gel (Mini-PROTEAN TGX precast gels, Bio-Rad), then transferred onto 0.45 µm pore size PVDF membranes (Millipore) using semidry immunoblotting (transfer buffer containing 25 mM Tris, 200 mM glycine and 20% methanol). Membranes were blocked with 5% nonfat milk in TBS-T (Tris Buffered Saline with 0.1% Tween-20) for 1 hour at room temperature, then incubated overnight at 4°C with primary antibodies diluted in 5% BSA in TBS-T. We used the following commercially available antibodies: mouse anti-CAMKIIβ (1:200; LS-B5767; LSBio), and mouse anti-β-actin (1:2000; Sigma). Membranes were washed 3 times for 15 minutes in TBS-T, followed by incubation for 1 hour at room temperature with HRP-conjugated rabbit anti-mouse secondary antibody (Bio-Rad), diluted 1:2000 in 5% nonfat milk in TBS-T. Membranes were washed 3 times for 15 minutes in TBS-T, then incubated with Pierce ECL Plus western blotting substrate (for CAMKIIβ) or Pierce ECL western blotting substrate (for β-actin) to detect western blotted proteins. We used the Image Quant LAS4000 Imaging System (GE Healthcare) to visualize protein bands. Image J software was used to quantify endogenous CAMKIIβ levels normalized to β-actin to ensure equal loading. The Quantification and Statistical Analysis Error bars shown in the figures represent standard error of the mean (s.e.m). One-way ANOVA analysis with post hoc Bonferroni test are used to compare different conditions (α = 0.05). n indicates the number of spines/neurons for spine imaging results and the number of cells for electrophysiology results. Asterisks denote the statistical significance (*p < 0.05). s.e.m of time constants is obtained by bootstrapping.

Method Details Plasmids

Molecular cloning and mutations were carried out using QuikChange site-directed mutagenesis kit (Agilent Technologies) and InFusion cloning kit (Clontech). Expression of Camuiα was under pCAG promoter. Camuiα (dimVenus-CaMKII-mEGFP or Green-Camuiα) was described previously ( Lee et al, 2009 ). We used dimVenus (Venus A208K, T145W ) instead of sREACh, which has slightly better characteristics as FRET donor ( Murakoshi et al., 2008 ), since this version has been already extensively characterized ( Lee et al., 2009 ). shRNA against CaMKIIβ ( Mus musculus ) were purchased from GE-Dharmacon. pGIPZ Camk2b shRNA (TCAGAGAGGAACTTCCCAG; V2LMM2804) were used to knock-down Camk2b . pGIPZ non-silencing shRNA (CTTACTCTCGCCCAAGCGAGAG) were used as a control. pCMV-CaMKIIβ ( Rattus ) is from Dr. Hayashi ( Okamoto et al, 2007 ).

Supplementary Material supplement