Abstract
Rapid developments in live-cell three-dimensional (3D) microscopy enable imaging of cell morphology and signaling with unprecedented detail. However, tools to systematically measure and visualize the intricate relationships between intracellular signaling, cytoskeletal organization and downstream cell morphological outputs do not exist. Here, we introduce u-shape3D, a computer graphics and machine-learning pipeline to probe molecular mechanisms underlying 3D cell morphogenesis and to test the intriguing possibility that morphogenesis itself affects intracellular signaling. We demonstrate a generic morphological motif detector that automatically finds lamellipodia, filopodia, blebs and other motifs. Combining motif detection with molecular localization, we measure the differential association of PIP2 and KrasV12 with blebs. Both signals associate with bleb edges, as expected for membrane-localized proteins, but only PIP2 is enhanced on blebs. This indicates that subcellular signaling processes are differentially modulated by local morphological motifs. Overall, our computational workflow enables the objective, 3D analysis of the coupling of cell shape and signaling.
🔬 Techniques
🔭 Microscopes
✨ Fluorophores
🧪 Sample Preparation
🔬 Cell Lines
🏭 Microscope Brands
🧪 Reagent Suppliers
💻 Software Details
💻 Code & Software
💾 Data Repositories
🏛️ Research Organizations (ROR)
Affiliated research institutions:
📋 Methods
Cell culture and genetic engineering
Cells were cultured at 5% CO 2 and 21% O 2 . MV3 melanoma cells (a gift from Peter Friedl at MD Anderson Cancer Center) were cultured using DMEM (Gibco) supplemented with 10% fetal bovine serum. Primary melanoma cells (a gift from Sean Morrison at UT Southwestern Medical Center) were cultured using the Primary Melanocyte Growth Kit (ATCC).
Human bronchial epithelial cells
(HBEC; a gift from John Minna at UT Southwestern Medical Center), immortalized with Cdk4 and hTERT expression and transformed with p53 knockdown, Kras V12 , and cMyc expression, 26 were cultured in keratinocyte serum-free medium (Gibco) supplemented with 50 mg/ml of bovine pituitary extract (Gibco), 5 ng/ml of EGF (Gibco), and 1% Anti-Anti (Gibco). U2OS osteosarcoma cells (a gift from Dick McIntosh at the University of Colorado, Boulder) were cultured using high-glucose DMEM (Gibco) supplemented with pyruvate, stable glutamine, and 10% fetal bovine serum. Conditionally immortalized hematopoietic precursors to dendritic cells 27 that express Lifeact-GFP 28 (a gift from Michael Sixt, IST Austria) were cultured and differentiated as previously described. 29 Unless stated otherwise, fluorescent constructs were introduced into cells using the pLVX lentiviral system (Clontech) and selected using antibiotic resistance to either puromycin or geniticin. The GFP-tractin construct contains residues 9–52 of the enzyme IPTKA 30 fused to GFP. 31 The CyOFP-tractin peptide contains the tractin peptide fused to the CyOFP protein. CyOFP is a cyan-excitable orange fluorescent protein with peak excitation at 505 nm and peak emission at 588 nm. 32 The GFP-Kras V12 plasmid was constructed by cloning a Kras V12 fragment from the pLenti-Kras V12 construct 26 into the pLVX-GFP vector. The biosensor for PIP 2 , PLCΔ-PH-GFP, encodes a PI(4,5)P2 lipid selective PH domain that can be used as a fluorescent translocation biosensor to monitor changes in the concentration of plasma membrane PI(4,5)P2 lipids. 33 Some MV3 cells expressing GFP in the cytosol and imaged via meSPIM, appeared in a previous publication, and were analyzed here as a control population. 10 For the CRISPR knockouts, U2OS cells were transiently transfected with pX458 including gene-specific guide RNAs together with a self-cleaving donor vector to deliver a blasticidin S resistant cassette into the genomic cut site. Cells were selected with 5 μg/ml blasticidin S and surviving colonies were isolated using 6 mm Pyrex cloning cylinders (Sigma-Aldrich). The pSpCas9(BB)-2A-GFP (pX458) was a gift from Dr. Feng Zhang (Addgene plasmid # 48138). The self-cleaving donor vector pMA-tial1 was a kind gift from Dr. Tilmann Buerckstuemmer (Horizon Genomics, Vienna, Austria). Guide RNA sequences were cloned into pX458 by Golden Gate cloning utilizing the BbsI cut site. Guide RNA sequences targeting Wave2 ( WASF2 ; exon 3) and cofilin-1 ( CFL1 ; exon 2) were 5’- TGAGAGGGTCGACCGACTAC −3’, and 5’- CGTAGGGGTCGTCGACAGTC −3’, respectively. Gene knockout was verified by western blotting using rabbit anti-cofilin-1 (Cell Signaling; D3F9 XP # 5175) and rabbit anti-Wave2 (Cell Signaling; D2C8 XP #3659) antibodies ( Supplementary Fig. 12 ).
Show full methods section
Cell culture and genetic engineering
Cells were cultured at 5% CO 2 and 21% O 2 . MV3 melanoma cells (a gift from Peter Friedl at MD Anderson Cancer Center) were cultured using DMEM (Gibco) supplemented with 10% fetal bovine serum. Primary melanoma cells (a gift from Sean Morrison at UT Southwestern Medical Center) were cultured using the Primary Melanocyte Growth Kit (ATCC).
Human bronchial epithelial cells
(HBEC; a gift from John Minna at UT Southwestern Medical Center), immortalized with Cdk4 and hTERT expression and transformed with p53 knockdown, Kras V12 , and cMyc expression, 26 were cultured in keratinocyte serum-free medium (Gibco) supplemented with 50 mg/ml of bovine pituitary extract (Gibco), 5 ng/ml of EGF (Gibco), and 1% Anti-Anti (Gibco). U2OS osteosarcoma cells (a gift from Dick McIntosh at the University of Colorado, Boulder) were cultured using high-glucose DMEM (Gibco) supplemented with pyruvate, stable glutamine, and 10% fetal bovine serum. Conditionally immortalized hematopoietic precursors to dendritic cells 27 that express Lifeact-GFP 28 (a gift from Michael Sixt, IST Austria) were cultured and differentiated as previously described. 29 Unless stated otherwise, fluorescent constructs were introduced into cells using the pLVX lentiviral system (Clontech) and selected using antibiotic resistance to either puromycin or geniticin. The GFP-tractin construct contains residues 9–52 of the enzyme IPTKA 30 fused to GFP. 31 The CyOFP-tractin peptide contains the tractin peptide fused to the CyOFP protein. CyOFP is a cyan-excitable orange fluorescent protein with peak excitation at 505 nm and peak emission at 588 nm. 32 The GFP-Kras V12 plasmid was constructed by cloning a Kras V12 fragment from the pLenti-Kras V12 construct 26 into the pLVX-GFP vector. The biosensor for PIP 2 , PLCΔ-PH-GFP, encodes a PI(4,5)P2 lipid selective PH domain that can be used as a fluorescent translocation biosensor to monitor changes in the concentration of plasma membrane PI(4,5)P2 lipids. 33 Some MV3 cells expressing GFP in the cytosol and imaged via meSPIM, appeared in a previous publication, and were analyzed here as a control population. 10 For the CRISPR knockouts, U2OS cells were transiently transfected with pX458 including gene-specific guide RNAs together with a self-cleaving donor vector to deliver a blasticidin S resistant cassette into the genomic cut site. Cells were selected with 5 μg/ml blasticidin S and surviving colonies were isolated using 6 mm Pyrex cloning cylinders (Sigma-Aldrich). The pSpCas9(BB)-2A-GFP (pX458) was a gift from Dr. Feng Zhang (Addgene plasmid # 48138). The self-cleaving donor vector pMA-tial1 was a kind gift from Dr. Tilmann Buerckstuemmer (Horizon Genomics, Vienna, Austria). Guide RNA sequences were cloned into pX458 by Golden Gate cloning utilizing the BbsI cut site. Guide RNA sequences targeting Wave2 ( WASF2 ; exon 3) and cofilin-1 ( CFL1 ; exon 2) were 5’- TGAGAGGGTCGACCGACTAC −3’, and 5’- CGTAGGGGTCGTCGACAGTC −3’, respectively. Gene knockout was verified by western blotting using rabbit anti-cofilin-1 (Cell Signaling; D3F9 XP # 5175) and rabbit anti-Wave2 (Cell Signaling; D2C8 XP #3659) antibodies ( Supplementary Fig. 12 ).
Imaging
Unless stated otherwise, imaging was performed via microenvironmental selective plane illumination microscopy, 10 a type of two-photon Bessel beam light sheet microscopy that confers near-isotropic resolution (300 nm lateral, 340 nm axial) and permits recording of cell behavior several millimeters from mechanically perturbing hard surfaces. Images were acquired at 37 °C in a non-descanned image capture mode with an axial step size of 160 or 200 nm and an excitation wavelength of 900 nm. Melanoma cells were imaged in cell culture medium supplemented with HEPES buffer to maintain pH during imaging. Confocal imaging was performed using a Zeiss LSM 780 with a 40x (1.4 NA) objective. Microglia were imaged within zebrafish using a Zeiss Lightsheet Z.1 with 20x detection (1.0 NA) and 5x illumination (0.1 NA) objectives. The zebrafish line was P2Y12::P2Y12-GFP and was 3.5 dpf.
Axially swept light-sheet microscopy
(ASLM) imaging was performed using a custom-built microscope as previously described. 9 U2OS cells were allowed to spread overnight in pH-neutralized rat-tail collagen (3 mg/ml) prior to imaging. All other cells, except for those imaged by the Peri and Betzig laboratories, were imaged in collagen gels created by mixing bovine collagen I (Advanced Biomatrix) with concentrated PBS and water to a collagen density of 2.0 mg/ml. This collagen solution was then neutralized with 1 M NaOH and mixed with cells just prior to incubation at 37 °C to induce collagen polymerization. U2OS cells and MV3 cells imaged via confocal microscopy were fixed in 4% paraformaldehyde prior to imaging.
Image deconvolution
All microscopy images shown are raw, non-deconvolved images. However, as a first analysis step, we deconvolved each 3D image. Most images acquired via meSPIM were Wiener deconvolved as previously described. 10 The microscope’s point spread function (PSF) was measured using fluorescent beads. The Wiener parameter, which is the inverse of the signal-to-noise ratio, was usually set to 0.018. However, to better detect the dim ends of filopodia, it was set to 0.015. For cytosolically labeled cells, we automatically estimated the Wiener parameter in each frame by defining the signal as the average fluorescence intensity within the cell and the noise as the standard deviation of the fluorescence intensity outside the cell. Supplementary Fig. 2 shows the effect of varying the Wiener and other deconvolution parameters, and Supplementary Table 5 shows the deconvolution and surface extraction parameters for all datasets presented in this paper. Since Wiener deconvolution is sensitive to PSF quality, for images acquired via microscopy modalities other than meSPIM, we used the Richardson-Lucy deconvolution algorithm built-in to Matlab. The movie of the MDA-MB-231 human breast cancer cell was deconvolved as previously described. 22 Following deconvolution, an apodization filter was applied to the optical transfer function (OTF) of the image in the spatial frequency domain. This filter had a value of 1 at the origin and decayed linearly to 0 at the edge of the filter support, which is set by the user as a percentage of the maximum OTF value. This threshold value, here termed the apodization height, was usually adjusted according to the homogeneity of the fluorescence label and the fineness of the morphological motif being detected. Higher apodization heights smooth the image more and allow for more robust detection of large objects, whereas lower apodization heights allow for the detection of finer structures but also admit more noise.
Cell surface extraction
The deconvolved images were further processed prior to cell surface extraction. For the majority of data sets, an Otsu threshold was first calculated from the 3D image, 34 holes were filled using a 3D grayscale flood-fill operation, and objects disconnected from the main cell were removed. We also optionally smoothed the image with a 3D Gaussian kernel and applied a gamma correction. Matlab’s isosurface function was then used to create a triangle mesh at the intensity value specified by the Otsu threshold. Finally, the triangle mesh was smoothed using curvature flow smoothing. 35 For some datasets, this procedure does not segment the nucleus along with the cytoplasm. In these cases, we therefore combined the output image of the procedure described above with an “inside” image that segmented the cell interior. To create the “inside” image from the gamma corrected image, we applied an additional gamma correction, smoothed the image with a 3D Gaussian kernel of standard deviation 2 pixels, Otsu thresholded the image, morphologically dilated the image, filled holes in each xy-slice, morphologically eroded the image by a radius greater than the morphological dilation, and finally smoothed the binary image with a 3D Gaussian kernel of width 1 pixel. Since this process shrinks the cell, if the parameters are chosen correctly the edges of the morphological motifs should mostly lay outside the “inside” image. To combine the “inside” image with the image outputted by the procedure above, we normalized this image by its Otsu threshold value, took the pixel-by-pixel maximum of this image and the “inside” image, and extracted a triangle mesh as an isosurface at an intensity level of 1. The ends of the long, thin lamellipodia of dendritic cells fail to segment using the techniques described above. To better segment lamellipodia, we combined the “inside” and normalized deconvolved images described above for PIP 2 labeled cells with a “surface filtered” image that enhances planar features, such as lamellipodia ( Supplementary Fig. 3 ). The surface filter, which was developed by Elliott et al. , 23 uses multiscale Gaussian second order partial-derivative kernels of the form (1) s ( x ) i , ω = 1 s i , ω 2 π ∑ x ′ x ′ ∈ Ω k ∂ 2 e − | x − x ′ | 2 2 σ i , ω 2 ∂ x i 2 I ( x ′ ) , where I ( x ) is the image intensity, σ i,ω is the half width of the Gaussian in dimension i at scale ω , Ω k is the filter kernel support, and s ( x ) ω is the filter response at scale ω . The total filter response, S ( x ), is merged across scales via (2, 3) S ( x ) = m a x ( { | s ( x ) ω | σ ω | ω = 1 , … , n } ) , σ ω = 2 ω − 1 . We used filter scales 1.5, 2, and 4 pixels to segment lamellipodia of various thicknesses. To combine the response of the surface filter with the “inside” and normalized deconvolved images, we normalized the response by subtracting both the mean image intensity and twice the standard deviation of the image intensity prior to dividing by the standard deviation of the image intensity. Although not used in this paper, our software also includes the option to segment cells by combining a normalized deconvolved image with a steerable filtered image. Steerable filters are computationally efficient edge detectors that, depending upon the parameters chosen, enhance linear or planar structures at specified scales. 36 , 37 Segmentations were spot checked by thresholding the 3D image at the isosurface intensity value immediately prior to mesh extraction and examining the overlaid raw and thresholded images as 3D image stacks in ImageJ 38 ( Supplementary Fig. 13 ). For analyses where internal mesh cavities could alter results, meshes were also exported to ChimeraX 39 for further examination. Segmentations that were found to be inaccurate or had cavities were excluded from further analysis. Decomposition of the cell surface into convex patches Although the image deconvolution and cell surface extraction parameters require customization for different cell types, the remainder of the workflow does not, and its parameters were kept constant throughout the paper. To decompose the cell surface into convex patches, we first performed a watershed segmentation of surface mean curvature, as previously described. 10 This oversegments the cell surface into small patches, which are analogous to superpixels in image analysis, which we later merge to create convex patches. First, we calculated the mean and Gaussian curvature at every triangle face. 17 , 23 Next, we constructed an adjacency graph of faces where each face is a node that is connected to exactly three other spatially adjacent faces. Matlab’s isosurface function does not always produce triangle meshes with sufficient topological consistency to create such a graph. Our software fixes common topological inconsistencies, such as triangular edges that are only connected to one face. Rarely, however, a face graph cannot be constructed. In these situations, very slightly changing the image deconvolution parameters usually solves the problem, although we did not need to do so here. Since curvature can be noisy, we next smoothed mean curvature in two different ways. First, we used a kd-tree to median filter curvature in 3D space over 2 pixels. The meSPIM is Nyquist sampled, and so 2 pixels, which is 320 nm, is approximately the microscope’s spatial resolution. Second, to reduce spurious curvature fluctuations, we diffused mean curvature on the mesh using a diffusion kernel 40 , 41 according to the equation (4) S = A ¯ k R for 20 iterations, where R is the curvature, A ¯ is a normalized, weighted adjacency matrix of the faces graph, k is the number of iterations, and S is the smoothed curvature. We defined A as (5) A i j = { 1 , if i = j 1 d i j , if i is adjacent to j 0 , otherwise where d ij is the distance between faces i and j . To normalize A , we multiplied it by a diagonal matrix, where each diagonal element was the inverse of the sum of that row. Next, we performed a watershed segmentation of the smoothed curvature over the cell surface. 18 Watershed segmentations are often performed on 2D images, where each pixel is adjacent to exactly four other pixels. Here, we similarly performed a watershed segmentation over the adjacency graph of faces, where each face is adjacent to exactly three faces. We next merged adjacent patches using a spill depth criterion. 18 Here, the spill depth between two adjacent patches was defined as the maximum curvature of the two patches minus the maximum curvature at the patch-patch interface. This is analogous to the depth of water that the patch can hold before spilling into the neighboring patch. Starting with the smallest spill depth, we merged patches until no spill depth was below a cutoff of 0.6 times the Otsu threshold of mean curvature for the cell. Supplementary Fig. 4 shows the effect of altering the spill-depth cutoff and other patch merging parameters. Finally, we decomposed the surface into approximately convex patches by iteratively applying the triangle and line-of-sight (LOS) criteria. To apply the triangle criterion, 10 we first calculated the closure surface area for each patch and pair of adjacent patches. We defined the closure surface area as the minimum additional surface area needed to create a closed polyhedron from a surface patch. We then merged adjacent patches if they meet the criterion (6) σ A + σ B − σ AB σ A σ B > ρ , where σ A and σ B are the closure surface areas of the two patches, σ AB is the closure surface area of the merged patch, and ρ is the triangle cutoff parameter, which we here set to 0.7. The triangle criterion can be thought of as similar to the law of cosines and intuitively seeks to merge patches that meet at small angles. Starting with the largest ρ , we merged all pairs of patches that met the triangle criterion before applying the LOS criterion. The LOS criterion merges adjacent patches with high mutual visibility. 19 , 42 We defined the mutual visibility of patches A and B as the percentage of line segments that connect a face in A with a face in B that are lines of sight, where a line of sight is a line segment that falls entirely within the mesh. We calculated mutual visibility by randomly selecting a face on each patch, and using a triangle-ray intersection 43 algorithm to determine whether a line segment connecting the two faces exited and reentered the mesh. A small patch and an adjacent very large patch may have a large mutual visibility because of lines of sight that extend across the width of the cell, even if these two patches should not be merged. When merging two patches, we therefore discarded line segments that were longer than twice the smaller patch size. Supplementary Fig. 14a shows the convergence of mutual visibility as a function of the number of line segments tested. We calculated mutual visibility from 20 line segments per pair of patches. In an exact convex decomposition, any two points within any patch could be connected by a line of sight. However, because of biological variation and image noise, requiring a mutual visibility of 1 is too strict a requirement for cell images. We instead merge patches if their mutual visibility is greater than 0.7. Starting with the largest mutual visibility between patch pairs, we merged all patch pairs meeting the LOS criterion, before again applying the triangle criterion. Having three patch merging criteria for convex surface decomposition allows us to balance accuracy, speed, and robustness to noise. The spill-depth criterion is fast but potentially inaccurate, whereas the LOS criterion is relatively slow, but exact. The triangle criterion implements the short-cut rule, 20 which biases merging towards certain types of convex decompositions. By adjusting the three merging parameters, users can control which criteria dominate in their analysis. Classification of morphological motifs To classify each patch by morphological motif, we first performed feature selection on the geometric patch features listed in Supplementary Table 1 . Implemented by the Matlab built-in function sequentialfs() , our sequential feature selection randomly successively removed features as long as doing so reduced the misclassification rate. The misclassification rate was measured using 10-fold cross validation. The geometric features selected can vary considerably from dataset to dataset even for similar training sets, presumably because of correlations between features, randomness, and dataset differences. For example, Supplementary Table 6 shows the features selected for bleb detection models generated by three different users training on the same four cells. In this example, no feature was selected by all three models, and no two models shared more than two selected features. Once features were selected, features were normalized to have the same mean and standard deviation, and a linear support vector machine (SVM) 44 was used to classify patches. Since SVM models vary from user to user, to analyze actin, Kras, and PIP 2 localization, we had models created by three different users vote on the classification of each bleb. We also validated our workflow with the linear SVM replaced with a radial SVM or a random forest. 45 Supplementary Table 6 shows the precision, recall, and F 1 score of these algorithms for various iterations of feature selection. For the radial SVM, we used the Gaussian kernel, (7) K ( x j , x k ) = e − ‖ x j − x k ‖ 2 . To implement the random forest, we used the treeBagger () function in Matlab. Measuring the out-of-bag classification error as a function of the number of trees grown, we observed that the error plateaued at approximately 10 trees, which is well below the 30 and 200 tree forests that we tested. To compare our workflow, which employs a supervised machine-learning algorithm, to an unsupervised algorithm, we performed an agglomerative hierarchical clustering on all the patches and the patches classified by the supervised algorithm as motifs of interest ( Supplementary Fig. 7 ), respectively. We used the correlation as a distance metric and measured the distance between a pair of clusters as the average distance between any two pairs of patches in these clusters. To avoiding biasing the algorithm, we only clustered on statistics defined at the patch scale, and did not include cell scale statistics, such as cell volume.
Characterization of patches
To classify patches by morphological motif, we calculated geometric descriptions of each patch. The full list of 23 features used by the SVM classifier is provided in Supplementary Table 1 . In calculating these features, mean curvature was smoothed as described above, but Gaussian curvature was not. We defined the average patch position as the mean location of the faces in the patch, and we similarly defined the weighted average patch position as the mean location of the faces weighted by curvature. The feature ‘variation from a sphere’ was defined by the standard deviation of the distances from a patch’s faces to the average patch position divided by the mean distance of those faces to the average patch position. We defined the closure surface area as described above. The closure center was also defined as the mean position of the mesh vertices at the patch edge. We defined the patch radius as the mean distance of the patch’s faces from the closure center. The volume, V , was calculated using the equation (8) V = 1 6 ∑ i N v 1 , i · ( v 2 , i × v 3 , i ) , where N is the number of faces, and v 1, i , v 2, i , and v 3, i are the vertices of face i . The vertices must be ordered such that the face normal extends outwards from the cell. To derive this equation, the mesh can be thought of as decomposed into tetrahedrons where the vertices of each tetrahedron are those of a face combined with the origin. 46 The signed volumes of the tetrahedrons sum to the volume of the mesh. Patches were closed prior to calculating their volumes. We calculated the shape diameter function similarly to Shapira et al. 47 For each patch, we randomly picked 20 mesh faces on the patch and extended a ray inwards from the mesh face at a randomly chosen angle within π /3 of the direction opposite to the face’s normal. We calculated the distance each ray traveled before intersecting the opposite side of the mesh. The shape diameter function of the patch was then defined as the mean travel distance within one standard deviation of the median distance.
Features selected for patch classification
The feature selection algorithm selected different geometric features to detect the three morphologies. To determine which geometric features best distinguished morphologies, starting from no features, we successively added the most discriminative feature to the model ( Supplementary Table 3 ). The features that best distinguished blebs from non-blebs were volume / (closure surface area) 3/2 and mean curvature on the protrusion edge. Closure surface area is the minimum amount of additional surface area needed to create a closed polygon from the mesh of the patch. The features that best distinguished filopodia from non-filopodia were the distance from the center of the closure surface area to the mean face position, a measure of morphological feature length, and patch surface area. This same measure of morphological feature length as well as patch volume were the best features for distinguishing lamellipodia from non-lamellipodia. Optional merging of convex patches Some morphological motifs, such as lamellipodia and flagella, are not convex but are composed of multiple convex regions. To detect such motifs, we optionally merge convex patches into patch composites. Since adjacent patches that compose a larger structure often have smooth curvature at their interface, we first merge patches using a modified line of sight criterion with line segment length capped at 10 pixels and a mutual visibility cutoff of 0.7. The line of sight criterion is described above. This step is not required for convex patch merging and can be disabled by the user. We next employed a more versatile machine learning based framework to merge adjacent patches. Using the geometric features for pairs of adjacent patches listed in Supplementary Table 2 , as well as user provided training data, we trained an SVM to automatically merge patches. We used the same feature selection procedure and SVM parameters as for patch classification.
Characterization of adjacent patches
To merge adjacent patches into patch composites using an SVM, we calculated geometric characterizations of each pair of adjacent patches. The full list of 36 features used by the SVM is provided in Supplementary Table 2 . Some measures of patch pairs incorporate individual patch measures, which are described above. Unless otherwise specified, mean curvature was smoothed as described above, but Gaussian curvature was not. To better describe the surface geometry at patch-patch interfaces, we calculated the two principal curvatures, κ 1 and κ 2 , everywhere on the cell surface, (9, 10) κ 1 = H + H 2 − K , κ 2 = H − H 2 − K , where H is the unsmoothed mean curvature and K is the unsmoothed Gaussian curvature. For various geometries defined by principal curvature values, we then calculated the fraction of the interface that had that geometry. As a noise threshold, we used the standard deviation of the smoothed mean curvature. Principal curvatures above this threshold or below the negative of this threshold were defined as large, and those more than four times above or below it as very large. We defined a ridged geometry as a large positive κ 1 and a small κ 2 , a very ridged geometry as a very large positive κ 1 and a small κ 2 , a valley-like geometry as a small κ 1 and a large negative κ 2 , a very valley-like geometry as a small κ 1 and a very large negative κ 2 , a domed geometry as a large positive κ 1 and a large positive κ 2 , a cratered geometry as a large negative κ 1 and a large negative κ 2 , a flat geometry as a small κ 1 and a small κ 2 , and a saddle-like geometry as a large positive κ 1 and a large negative κ 2 .
Generation of training data
We designed a graphical user interface to enable the collection of training data necessary for motif classification. Users are shown a surface rendering of a cell with surface patches outlined and can interact with the cell by rotating and moving it, and zooming in and out on regions of interest. To generate data for patch classification, we asked users to click on patches that are certainly the morphological motif of interest and then subsequently asked them to click on patches that are certainly not that motif. Similarly, to generate data for the optional step of convex patch merging, we asked users to click on pairs of patches that should certainly be merged and then asked them to click on pairs of patches that should certainly not be merged. Pairs of patches that were not adjacent were automatically excluded from the training set. We have successfully tested this interface in Matlab versions R2017b and R2013b. However, since in Matlab user interface functionality can vary from version to version, it may not work in some versions of Matlab.
Validation
To validate the protrusion classification, we calculated the F 1 score, which is the harmonic mean of precision and recall. Here, precision is defined as the ratio of patches correctly classified as protrusions to the total number of patches classified as protrusions, whereas recall is defined as the ratio of patches correctly classified as protrusions to the total number of patches that are protrusions. Unless otherwise specified, in calculating the F 1 score, we only used patches selected by the trainer as certainly a protrusion or certainly not a protrusion.
Generation and analysis of synthetic images
For algorithm validation, we created synthetic spherical cells of radius 48 pixels. The cell size was chosen to mimic the pixel spacing on the meSPIM of 0.16 μm per pixel for a cell 7.6 μm in radius. Placed randomly on the cells’ surfaces were spherical blebs that ranged in radius from 2 to 32 pixels and in number from 4 to 256 per cell. (See Supplementary Fig. 15 for example synthetic cells). Since pixelation at the cell edge could hamper the cell surface extraction and subsequent analysis, edge pixels were subdivided into a finer 3D grid to calculate the percentage of the pixel occupied by the synthetic cell. The final synthetic images were saved with 32 grayscale intensity values. Synthetic cells were not deconvolved, but the remainder of the analysis workflow was identical to that used for microscopic data. The same surface extraction parameters were used as for bleb detection on tractin and cytosolically labeled cells. An F 1 score does not measure whether or not the workflow preferentially detects certain subtypes of protrusions. Since patch-merging algorithms could be sensitive to protrusion size, we used synthetic data to test the algorithm’s sensitivity to bleb size ( Supplementary Fig. 15 ). On synthetic cells of radius 7.6 μm (48 pixels) we simulated blebs ranging in radius from 0.32 μm (2 pixels) and 0.64 μm (4 pixels) to 5.1 μm (32 pixels). Although only 70% of the smallest 0.32 μm radii blebs were decomposed as convex surface patches, almost all of the larger blebs were decomposed. A bleb detector trained on synthetic data correctly classified all blebs that were decomposed as convex surfaces. Mapping fluorescence intensity to the cell surface To measure the fluorescence intensity local to each mesh face, we used the raw, non-deconvolved, fluorescence image. At each mesh face, we used a kd-tree to measure the average pixel intensity within the cell and within a sampling radius of the mesh face. To correct for surface curvature dependent artifacts, we depth normalized 23 the image prior to measuring intensity localization by normalizing each pixel by the average pixel intensity at that distance interior to the cell surface. Prior to analysis, we also normalized each cell’s surface intensity localization to a mean of one.
Calculation of distance from a bleb edge
On the adjacency graph of faces, we calculated the distance from each face to the nearest bleb edge measured in number of faces traversed. To convert this distance to micrometers, we multiplied by the average distance between faces for each cell in each frame. Since the distance in micrometers between adjacent faces varies, our calculation of distance is an estimate rather than exact.
Calculation of local bleb density
To calculate bleb density, we first assigned the value one to each mesh face on a bleb and the value zero to each mesh face not on a bleb ( Supplementary Fig. 11a ). We then diffused these values on the mesh surface using Eq. 4 over 600 iterations ( Supplementary Fig. 11b ). We choose the number of iterations such that the bleb density would be calculated over a short distance on the order of a bleb length. Eq. 4 does not allow an exact measurement of bleb density and may be unstable over distances on the order of many bleb lengths.
Spherical statistics
The von Mises-Fisher distribution is defined on an R d − 1 sphere within R d space. 48 For d = 2 dimensions it approximates a wrapped normal distribution on a circle, and, similar to the normal distribution, for any d is parameterized by a mean and an inverse spread. For d = 3 dimensions, the von-Mises Fisher distribution is (11) p ( x ; μ , κ ) = κ 2 π ( e κ − e − κ ) e x p ( κ μ ′ x ) , where μ is the mean direction parameter and κ is the concentration parameter, which is inversely related to the data spread. The maximum likelihood estimate of the mean direction is simply (12) μ = ∑ i N x i | ∑ i N x i | . A Newton’s Method approximation for κ , κ 2 , in three dimensions is (13, 14) R ¯ = | ∑ i N x i | N , A ( κ ) = I 3 2 ( κ ) I 1 2 ( κ ) , (15) κ ^ = R ¯ ( 3 − R ¯ 2 ) 1 − R ¯ 2 , (16) κ ^ 1 = κ ^ − A ( κ ^ ) − R ¯ 1 − A ( κ ^ ) 2 − 2 κ ^ A ( κ ^ ) , (17) κ ^ 2 = κ ^ 1 − A ( κ ^ 1 ) − R ¯ 1 − A ( κ ^ 1 ) 2 − 2 κ ^ 1 A ( κ ^ 1 ) , where N is the number of data vectors and I are Bessel functions of the first kind. 48 In Fig. 6c and j , we measured the magnitude of PIP 2 and Kras V12 polarization by mapping the intensity values defined on each surface mesh onto a unit sphere and then using spherical statistics to calculate κ . To map the intensities onto the unit sphere, we calculated a set of unit vectors, x intensity that extended in the direction from the cell center to every mesh face. The cell center was defined as the location within the cell farthest from the cell edge,. Since we measured intensity at every mesh face over a radius of 2 μm, to avoid spatially oversampling, we used only every 1000 th mesh face. We defined w intensity as the measured intensity value associated with each unit vector and then discretized the range of intensity values into 32 bins. Finally, we replaced every vector x intensity with w copies of that vector and calculated κ from this set of unit vectors. As a control, we also measured κ from a set of x intensity with randomized directions. In Fig. 6d and k we computed the directional correlation of morphological motifs, here blebs, with intensity localization. In each frame, we defined the directional correlation as μ blebs · μ intensity . To measure μ blebs , we calculated a set of unit vectors, x blebs , that extended in the direction from the cell center to each mesh face on a bleb. To measure μ intensity , we calculated x intensity and in Eq. 12 we weighted x i by the intensity localization. Since the cell is not a sphere and most cells have polarized shapes, the surface itself is expected to have a nonrandom μ and a small κ . To account for this, we created a control distribution of directional correlations μ blebsRand · μ intensity , where μ blebsRand was calculated from a set of vectors where the patch classification was randomly permuted. In each frame, we created 200 such permutations by randomly assigning patches to be a bleb or not a bleb.
Measurement of boundary motion
To measure boundary motion, for each face we found the closest face in the previous frame using a kd-tree. We then defined the boundary motion as (18) m i = − s i g n ( d i · n i ) | d i | , where m i is the boundary motion at face i , d i is the vector from face i to the closest point in the previous frame, and n i is the normal to the surface at face i . This is not an ideal measure of boundary motion since the mapping vectors d i may cluster on select faces of the previous frame’s surface, or even alter the topology among faces, in a physically unrealistic manner (see Machacek et al. 49 for an illustration of these problems with 2D boundaries). As a control, we also calculated the boundary motion for each face by finding the closest point in the next frame. Supplementary Fig. 14b shows the protrusive and retractive motion of six cells using both definitions of boundary motion. Here, backwards motion is the mapping of points from each frame to the previous frame and is the definition used elsewhere, and forwards motion is the mapping of points from each frame to the subsequent frame. Even though the backwards and forwards motions of the cells are different, in both cases blebs are more protrusive than non-blebs. This measure is also not a subpixel measure of motion, and should not be used to measure subpixel motions. Because we map each face to the closest face rather than the closest surface point in the previous frame, motions that are less than the average distance between faces will be undersampled in the motion distribution.
Statistical hypothesis testing
For each Kras and PIP 2 labeled cell, we measured the mean intensity localization of faces on and off blebs and then performed a one-sided t-test on the differences of the means after testing for normality using a Kolmogorov-Smirnov test. The Cohen’s d effect size was measured. Unless otherwise indicated, all errors and error bars show the standard error of the mean.
Surface rendering
The majority of triangle meshes were rendered in ChimeraX. 39 Colored triangle meshes were exported from Matlab as Collada .dae files using custom-written code and were rendered using full lighting mode. Lighting intensity and ambient intensity were adjusted. Colormaps were modified from colorBrewer. 50 The surfaces in Supplementary Figures 11 , and 15 were rendered within Matlab. Our software is capable of rendering all meshes shown in the paper within Matlab, as well as creating Collada files for export to ChimeraX.
Data availability
Data are available from the corresponding author upon reasonable request.
Code availability
The latest version of the software described here, as well as a user’s guide, is available from https://github.com/DanuserLab/Motif3D .
Supplementary Material 1535603_Supp_Fig1-15 1535603_Supp_Tab1-6 1535603_vid5 1535603_vid2 1535603_vid3 1535603_vid1 1535603_vid4
📊 Figures
Figure 1.
Cell morphology and signaling are coupled.
Surface renderings of (a) a dendritic cell expressing Lifeact-GFP, (b) an MV3 melanoma cell expressing tractin-GFP, and (c) a human bronchial epithelial cell (HBEC) expressing tractin-GFP. (d-f) Maxim...
Figure 2.
Morphological motif detection framework and example workflow.
To detect morphological motifs, ( a ) following image acquisition, ( b ) we extract the cell surface, ( c ) decompose that surface into convex patches, ( d ) optionally merge those patches, ( e ) and ...
Figure 3.
Detected blebs, filopodia, and lamellipodia.
(a) Blebs detected on an MV3 melanoma cell (representative of 19 cells), (b) filopodia detected on an HBEC cell (representative of 13 cells), and (c) lamellipodia detected on a dendritic cell (represe...
Figure 4.
Validation and robustness of morphological motif detection.
(a) A multiclass detector applied to cells derived from a human melanoma xenograft cultured in mice (representative of 9 cells). Filopodia are shown blue, blebs are shown red, and areas with neither f...
Figure 5.
Motif detection on images acquired via diverse microscopic techniques.
(a) A MIP, taken over the xz direction, of an MV3 cell expressing tractin-GFP imaged via laser scanning confocal microscopy (representative of 8 cells). (b) Blebs detected on the same cell using a mod...
Figure images are served from the NIH/NLM PubMed Central Open Access Subset or Europe PMC; copyright remains with the publishers and authors.
💬 Discussion
0 commentsNo comments yet. Be the first to start a discussion!
Leave a Comment