⭐ High Impact

Minimal genetically encoded tags for fluorescent protein labeling in living neurons.

Arsić Aleksandra, Hagemann Cathleen, Stajković Nevena, Schubert Timm, Nikić-Spiegel Ivana

📰 Nature communications 📅 2022 📊 68 citations

Abstract

Abstract Modern light microscopy, including super-resolution techniques, has brought about a demand for small labeling tags that bring the fluorophore closer to the target. This challenge can be addressed by labeling unnatural amino acids (UAAs) with bioorthogonal click chemistry. The minimal size of the UAA and the possibility to couple the fluorophores directly to the protein of interest with single-residue precision in living cells make click labeling unique. Here, we establish click labeling in living primary neurons and use it for fixed-cell, live-cell, dual-color pulse–chase, and super-resolution microscopy of neurofilament light chain (NFL). We also show that click labeling can be combined with CRISPR/Cas9 genome engineering for tagging endogenous NFL. Due to its versatile nature and compatibility with advanced multicolor microscopy techniques, we anticipate that click labeling will contribute to novel discoveries in the neurobiology field.

🔬 Techniques

🔭 Microscopes

🧬 Organisms

💻 Software

✨ Fluorophores

🧪 Sample Preparation

🔬 Cell Lines

🏭 Microscope Brands

Zeiss Leica Nikon Hamamatsu Lumencor

🧪 Reagent Suppliers

📷 Detectors

🔎 Objectives

🎨 Filters

💻 Software Details

Image Acquisition:
NIS-Elements LAS X ZEN
Image Analysis:
Huygens Fiji
General:
SPSS Excel

📋 Protocols

💾 Data Repositories

🏷️ Research Resource Identifiers (RRIDs)

Verified research resources used in this paper:

🏛️ Research Organizations (ROR)

Affiliated research institutions:

📋 Methods

✔ Verified methods section 6,006 words Read on PMC ↗

Cell culture Mouse neuroblastoma × rat neuron hybrid

ND7/23 cells were purchased from Sigma-Aldrich (ECACC 92090903). They were grown in high-glucose Dulbecco’s Modified Eagle Medium (DMEM; ThermoFisher Scientific, cat. no. 41965062) supplemented with 10% heat-inactivated fetal bovine serum (FBS; ThermoFisher Scientific, cat. no. 10270106), 1% penicillin–streptomycin (PS; Sigma-Aldrich, cat. no. P0781), 1% sodium pyruvate (ThermoFisher Scientific, cat. no. 11360039) and 1% l -glutamine (ThermoFisher Scientific, cat. no. 25030024). FBS was inactivated by incubation at 56 °C for 30 min. Cells were passaged three times per week, and used for transfections at passages 3–15. For microscopy experiments, ND7/23 cells were seeded on eight-well Lab-Tek II chambered cover glasses (German #1.5 borosilicate glass; ThermoFisher Scientific, cat. no. 155409) at a density of 25,000 cells per well. Prior to cell seeding, the cover glasses were coated with a 10 µg/ml solution of poly- d -lysine (Sigma-Aldrich, cat. no. P6407) in double-distilled water (ddH 2 O) for a minimum of 4 h at room temperature (RT). Chambered cover glasses were washed three times with ddH 2 O and allowed to dry prior to cell seeding. For lysis and western blot analysis, ND7/23 cells were seeded in 6-well plates (Greiner Bio-One, cat. no. 657160), at a density of 200,000 cells per well. Primary mouse cortical neurons (MCNs) from C57BL/6 embryonic day 17 were purchased from ThermoFisher Scientific (cat. no. A15586). They were thawed and cultured according to the manufacturer’s recommendation in a B-27 Plus Neuronal Culture System consisting of Neurobasal Plus (NB Plus) medium and B27 Plus supplement (ThermoFisher Scientific, cat. no. A3653401). Culturing medium was prepared by adding 2% of B27 Plus supplement and 1% of PS to Neurobasal Plus + (NB Plus +). For widefield and confocal microscopy experiments, MCNs were seeded on eight-well Lab-Tek II chambered cover glasses at a density of 90,000–110,000 cells per well. For experiments that did not require transfection, MCNs were seeded at a density of 70,000 cells per well. For STED imaging, MCNs were seeded on eight-well µ-slides with glass bottoms (Ibidi cat. no. 80827), at a density of 100,000 cells per well. For experiments that involved isolation of neuronal genomic DNA or total RNA, MCNs were seeded in 12-well plates (Corning Incorporated, cat. no. 3512), at a density of 500,000–1 million cells per well. The bottoms of the Lab-Tek chambers, µ-slides, and 12-well plates were pre-coated with a 20 µg/ml solution of poly- d -lysine in ddH 2 O for 2 h at RT. Prior to cell seeding, they were washed three times with ddH 2 O, allowed to dry, and then pre-incubated for at least 30 min with NB Plus + medium. During the culturing of the MCNs, half the NB Plus + medium was exchanged twice per week. Constructs, cloning, and mutagenesis The cDNA encoding for mouse neurofilament light chain (NFL) was amplified from the vector pmNFL (a gift from Anthony Brown, Addgene plasmid #83127; http://n2t.net/addgene:83127 ; RRID: Addgene_83127) 77 and initially cloned in an mEGFP-N1 plasmid (a gift from Michael Davidson, Addgene plasmid #54767; http://n2t.net/addgene:54767 ; RRID: Addgene_54767) using HindIII (ThermoFisher Scientific, cat. no. FD0504) and ApaI (ThermoFisher Scientific, cat. no. FD1414) enzymes. In the resulting construct, the TAG amber stop codon was introduced at positions K211, K363, R438, and K468 of the NFL cDNA, via PCR-based site-directed mutagenesis. After the mutagenesis, GFP was excised from all constructs using the enzymes BamHI (ThermoFisher Scientific, cat. no. FD0054) and NotI (ThermoFisher Scientific, cat. no. FD0595), and replaced by a double-stranded DNA oligonucleotide containing the FLAG tag sequence (DYKDDDDK). The FLAG tag oligonucleotide was synthesized by Sigma-Aldrich as two complementary single-stranded oligonucleotides (Supplementary Table 3 ). FLAG-NFL TAG constructs were cloned by excising the NFL WT -FLAG-encoding sequence from the pCMV backbone and replacing it with the FLAG-NFL TAG -encoding sequence, using the enzymes HindIII and NotI. The DNA encoding FLAG-NFL TAG was amplified by PCR from the NFL TAG -GFP plasmids using the forward primer that contained the FLAG-encoding sequence (Supplementary Table 3 ). FLAG-NFL WT construct was cloned next by using enzymes KpnI (ThermoFisher Scientific, cat. no. FD0524) and PvuI (ThermoFisher Scientific, cat. no. FD0624) to excise the K363TAG-containing DNA fragment from the FLAG-NFL K363TAG construct and replace it with the corresponding WT sequence. Together with NFL, we co-transfected neurofilament medium chain (NFM) cDNA-containing plasmid pmNFM (a gift from Anthony Brown, Addgene plasmid #83126; http://n2t.net/addgene:83126 ; RRID: Addgene_83126) 77 . For the experiments involving amber codon suppression of overexpressed NFL TAG mutants, we used a previously published pcDNA3.1/Zeo(+) plasmid 26 containing a sequence that encodes Methanosarcina mazei pyrrolysyl-tRNA synthetase with a nuclear export signaling sequence and Y306A, Y384F substitutions (NES PylRS AF ), and one copy of tRNA CUA Pyl under the control of the U6 promoter (a kind gift from Edward Lemke’s laboratory, EMBL, Heidelberg, and IMB, Mainz). For the experiments involving amber codon suppression of endogenous NFL and βIII-tubulin, as well as western blot analysis, we used a pcDNA3.1/Zeo(+) plasmid containing codon-optimized sequence that encodes Methanosarcina mazei NES PylRS AF and one copy of tRNA CUA Pyl . The codon-optimized sequence encoding the NES PylRS was synthesized by GenScript and cloned into the pcDNA3.1/Zeo(+) vector. We subsequently added tRNA CUA Pyl and the U6 promoter or the 4xU6-M15tRNA CUA 27 cassette upstream of the CMV promoter in the reverse direction by cloning, using BglII (ThermoFisher Scientific, cat. no. FD0083) and MfeI (ThermoFisher Scientific, cat. no. FD0753) enzymes. The U6 promoter-tRNA cassette synthesized by GenScript or pNEU-hMbPylRS-4xU6M15 plasmid (a gift from Irene Coin, Addgene plasmid #105830; http://n2t.net/addgene:105830 ; RRID:Addgene_105830) 27 were used as a template for the cloning. For the amber codon suppression of endogenous proteins as well as western blot analysis, we also co-transfected cells with eukaryotic release factor 1 E55D mutant (eRF1 E55D ). This plasmid was cloned by Christopher D. Reinkemeier in Edward Lemke’s laboratory. For the labeling of endogenous βIII-tubulin, we used a pORANGE Tubb3-GFP KI plasmid (a gift from Harold MacGillavry, Addgene plasmid #131497; http://n2t.net/addgene:131497 ; RRID: Addgene_131497) 44 . For the optimization of genetic code expansion of endogenous βIII-tubulin, we replaced GFP from this construct with GFP Y39TAG by cloning with HindIII (ThermoFisher Scientific, cat. no. FD0504) and XhoI (ThermoFisher Scientific, cat. no. FD0694) restriction sites. In order to label endogenous NFL, we designed and cloned target and donor sequences following the previously published protocol 44 . The NFL target sequence GAGTGCTGGAGAGGAGCAGG ( https://wge.stemcell.sanger.ac.uk//crispr/377510968 ) was selected using the Ensembl browser 78 [Ensembl release 102, November 2020; Mus musculus version 102.38 (GRCm38.p6), Chromosome 14: 68,087,408–68,087,430] based on available PAM sites at the end of the Nefl gene. The integration site is Q537 and the knock-in results in the deletion of six C-terminal amino acids of the NFL protein. The target sequence was subsequently cloned into the pORANGE cloning template vector (a gift from Harold MacGillavry Addgene plasmid #131471; http://n2t.net/addgene:131471 ; RRID: Addgene_131471) 44 using the BbsI enzyme (ThermoFisher Scientific, cat. no. FD1014) and single-stranded DNA oligonucleotides synthesized by Sigma-Aldrich. In the next step, we cloned a donor sequence containing linker -3xFLAG ( GSAGSA -DYKDHDGDYKDHDIDYKDDDDK) or linker A6TAG -3xFLAG ( GSAGS*- DYKDHDGDYKDHDIDYKDDDDK) into the resulting plasmid (pORANGE NFL KI), using the enzymes HindIII and BamHI. The donor sequences were amplified by PCR from existing plasmids. For labeling of the endogenous NFL via Targeted Knock-In with Two guides approach (TKIT) 46 we selected two target sequences in the Nefl gene, using the Ensembl browser 78 . First target sequence (gRNA1; https://wge.stemcell.sanger.ac.uk//crispr/377510942 ) is located in the last intron (intron 3) of Nefl gene, 114 bp upstream of the start of the last exon (exon 4). Second target sequence (gRNA2; https://wge.stemcell.sanger.ac.uk//crispr/377510985 ) is located in the 3′ untranslated region (UTR) of the Nefl gene, 107 bp downstream of the STOP codon. Both target sequences were synthetized by Sigma-Aldrich as single-stranded DNA oligonucleotides and were separately cloned into the pORANGE cloning template vector using the BbsI enzyme. The plasmid containing gRNA2 was subsequently used as a template for PCR amplification of the U6 promoter-gRNA2 cassette, which was then cloned in the multiple cloning site of the plasmid containing gRNA1, using enzymes XbaI (ThermoFisher Scientific, cat. no. FD0684) and SalI (ThermoFisher Scientific, cat. no. FD0644). The resulting construct contains U6 promoter-gRNA1 followed by U6 promoter-gRNA2 as well as spCas9 expressed from the CAG promoter. Donor sequences for TKIT knock-in were synthetized by Eurofins Genomics and contain the following sequences: reverse complement sequence of gRNA2 followed by a part of Nefl intron 3, whole Nefl exon 4 with the addition of linker WT -3xFLAG sequence or linker A6TAG -3xFLAG sequence, a part of the 3′ UTR and a reverse complement sequence of gRNA1. Subsequently, both WT- and A6TAG-linker-containing donor sequences were cloned upstream of the CMV promoter in the pcDNA3.1/Zeo(+) and in the pcDNA3.1/Zeo(+)-mCherry vectors. For the experiments involving the combination of TKIT-based knock-in and amber codon suppression, pcDNA3.1/Zeo(+) vector containing tRNA CUA Pyl and codon-optimized sequence encoding NES PylRS AF was modified to include internal ribosomal entry site (IRES) followed by eRF1 E55D -encoding sequence. All primer and oligonucleotide sequences used for cloning and mutagenesis are listed in Supplementary Table 3 . Donor sequences for ORANGE- and TKIT-based knock-in and primers used for PCR amplification and sequencing of genomic DNA and cDNA are listed in Supplementary Table 4 . UAAs, tetrazine derivatives of fluorescent dyes, and antibodies In this study, the following unnatural amino acids (UAAs) were used: trans -cyclooct-2-en- l -lysine (TCO*A-Lys; Sirius Fine Chemicals, SICHEM, cat. no. SC-8008), trans -cyclooct-4-en- l -lysine (TCO4en/eq-Lys; a kind gift from Edward Lemke’s laboratory, also available from SICHEM, cat. no. SC-8060) and endo -bicyclo[6.1.0]nonyne-lysine (endo-BCN-Lys; SICHEM cat. no. SC-8014). For SPIEDAC labeling, the following tetrazine derivatives of fluorescent dyes were used: ATTO655-methyltetrazine (ATTO655-me-tz; ATTO-TEC GmbH, cat. no. AD 655-2502), ATTO488-tetrazine (ATTO488-tz; Jena Bioscience, cat. no. CLK-010-02), CF500-methyltetrazine (CF500-me-tz; Biotium cat. no. 96029), CF650-methyltetrazine (CF650-me-tz; Biotium cat. no. 96036), Janelia Fluor 646-methyltetrazine (JF646-me-tz; Jena Bioscience custom synthesis), Janelia Fluor 549-tetrazine (JF549-tz; Tocris cat. no. 6502), silicon rhodamine-tetrazine (SiR-tz; SpiroChrome cat. no. SC008), Alexa Fluor 647-tetrazine (AF647-tz; a kind gift from Edward Lemke’s laboratory), TAMRA-tetrazine (TAMRA-tz; Jena Bioscience cat. no. CLK-017-05), and BODIPY-tetrazine (BODIPY-tz; Jena Bioscience cat. no. CLK-036-05). For immunocytochemistry and western blot, the following antibodies were used: rabbit anti-FLAG antibody (Merck Millipore cat. no. F7425), mouse anti-FLAG M2 antibody (Sigma-Aldrich, cat.no. F1804), mouse anti-neurofilament 70 kDa antibody, clone DA2 (Merck Millipore cat. no. MAB1615), mouse anti-βIII-tubulin antibody (BioLegend, cat. no. 801202), goat anti-rabbit Alexa Fluor (AF) 488 Plus (ThermoFisher Scientific, cat. no. A32731), goat anti-rabbit AF555 (ThermoFisher Scientific, cat. no. A21429), goat anti-mouse AF555 (ThermoFisher Scientific, cat. no. A21424), goat anti-rabbit AF647 Plus (ThermoFisher Scientific, cat. no. A32733), goat anti-mouse AF488 Plus (ThermoFisher Scientific, cat. no. A32723), goat anti-mouse AF647 Plus (ThermoFisher Scientific, cat. no. A32728), goat anti-rabbit horseradish peroxidase (HRP; ThermoFisher Scientific, cat. no. A16104), and goat anti-mouse HRP (ThermoFisher Scientific, cat. no. A16072). Transfections Both ND7/23 cells and MCNs were transfected using the Lipofectamine 2000 transfection reagent (ThermoFisher Scientific, cat. no. 11668027). ND7/23 cells were transfected 14–20 h after seeding into an eight-well Lab-Tek chambered slide, with a slightly modified manufacturer’s protocol using a DNA/Lipofectamine 2000 ratio of 1 µg:2.4 µl and up to 0.625 µg of total DNA per well. Immediately after transfection, a stock solution of UAA (100 mM in 0.2 M NaOH containing 15% DMSO) was diluted 1:4 in 1 M HEPES (ThermoFisher Scientific, cat. no. 15630080) and added to cells to a final concentration of 250 µM for TCO*A-Lys and TCO4en/eq-Lys, and 1 mM for endo-BCN-Lys. The medium was replaced after incubation for 6 h (37 °C, 5% CO 2 ), and the HEPES-diluted UAA was again added before cells were incubated overnight (37 °C, 5% CO 2 ). For the transfection of MCNs, we adapted a previously published protocol 79 using Lipofectamine 2000. As was done for ND7/23 cells, we used a DNA/Lipofectamine 2000 ratio of 1 µg:2.4 µl. The total amount of DNA per well in an eight-well Lab-Tek chambered slide was up to 1.25 µg. DNA and Lipofectamine 2000 solutions were prepared in NB Plus medium with 1% of PS. Prior to their addition to the cells, transfection solutions were mixed with an equal volume of warm NB Plus medium containing 4% B27 Plus to obtain a final B27 Plus content of 2%. These final transfection mixtures were then warmed by incubation for 5 min (37 °C, 5% CO 2 ). The culturing medium was aspirated from neurons and retained for use as conditioned medium (CM), and warm transfection mixture was added dropwise to cells. After incubation for 4–6 h, the transfection medium was aspirated, and the retained CM was added back to cells. If the transfection was performed on the day of medium change, half the volume of CM was put back to the cells and topped up with fresh NB Plus + medium. Afterward, 100 mM TCO*A-Lys, endo-BCN-Lys or TCO4en/eq-Lys stock (in 0.2 M NaOH containing 15% DMSO) was diluted 1:4 in 1 M HEPES and added to neurons, to a final concentration of 250 µM. MCNs were incubated (37 °C, 5% CO 2 ) for a minimum of two days prior to click labeling. The exact labeling time points are described in figure legends. For NFL TAG overexpression experiments, MCNs were transfected at day in vitro (DIV) 8, and for the labeling of endogenous NFL with pORANGE or TKIT vectors, MCNs were transfected at DIV5. For the labeling of endogenous βIII-tubulin with pORANGE vectors, MCNs were transfected at DIV3. For lysis and western blot analysis, ND7/23 cells were transfected 14–20 h after seeding in 6-well plates using the Lipofectamine 2000 transfection reagent. DNA/Lipofectamine 2000 ratio was 1 µg:2.4 µl and the total DNA amount was 5.25 µg/well. Alternatively, cells were transfected using the calcium phosphate method. Briefly, per well of a 6-well plate, 25 µl of 1 M calcium chloride (Sigma-Aldrich, cat. no. C5670) was mixed with 5.25 µg of DNA, and sterile water was added up to 100 µl. This mixture was added dropwise to 100 µl of 2× HBS (50 mM HEPES, 280 mM NaCl, 1.5 mM Na 2 HPO 4 , pH 7), slowly, while flicking the tube to mix the solutions. After 10 min of incubation, transfection mixtures were added dropwise to cells. Immediately after transfection, a stock solution of TCO*A-Lys (100 mM in 0.2 M NaOH containing 15% DMSO) was diluted 1:4 in 1 M HEPES and added to cells to a final concentration of 250 µM. The medium was replaced after incubation for 6 h (37 °C, 5% CO 2 ), and the HEPES-diluted TCO*A-Lys was again added before cells were incubated overnight (37 °C, 5% CO 2 ). Single-color click chemistry labeling in live ND7/23 cells and neurons with cell-permeable dyes ND7/23 cells expressing NFL WT -FLAG or NFL TAG -FLAG mutants were labeled by SPIEDAC click chemistry after overnight (18-20 h) incubation with the UAA. To wash out excess UAA, medium containing the UAA was removed, cells were washed twice with culturing medium and then incubated 2 h in a fresh culturing medium. Cells were washed once more with culturing medium and incubated for 10 min (37 °C, 5% CO 2 ) with the tetrazine dye diluted in culturing medium. The concentration of tetrazine dyes was 5 µM, except for JF549-tz, which was used at a concentration of 2.5 µM. After incubation for 10 min, the dye-containing medium was aspirated, cells were washed twice and then incubated for 2 h in fresh culturing medium. Afterward, the culturing medium was aspirated, cells were washed once with 0.01 M phosphate-buffered saline (PBS; 137 mM NaCl, 10 mM Na 2 HPO 4 , 1.8 mM KH 2 PO 4 , 2.7 mM KCl, pH 7.4) and fixed with 4% paraformaldehyde (PFA; Sigma-Aldrich, cat. no. 158127) in 0.1 M phosphate buffer (PB) for 15 min at RT. After fixation, the FLAG tag was labeled by immunocytochemistry. Live-cell click chemistry labeling of MCNs was performed 2–3 days (overexpression experiments) or 6 days (labeling of endogenous NFL with pORANGE or TKIT vectors) after transfection. First, medium containing the UAA was removed, neurons were washed twice with fresh NB Plus +, and then incubated for 2–3 h (37 °C, 5 % CO 2 ) in a 1:1 mixture of fresh NB Plus + and CM (collected either on the day of transfection, or from neurons cultured only for this purpose). Afterward, neurons were washed once more with fresh NB Plus + and incubated with the tetrazine dye diluted in fresh NB Plus + for 10 min (37 °C, 5% CO 2 ). The concentrations of dyes were the same as for the labeling in ND7/23 cells. After the labeling period, neurons were washed twice with fresh NB Plus + and incubated for 2–3 h in a 1:1 mixture of fresh NB Plus + and CM. For the click chemistry labeling background measurements, neurons were incubated either 2 h or 10 h after the labeling. The culturing medium was then aspirated, and neurons were fixed with 4% electron microscopy grade PFA (Electron Microscopy Sciences, cat. no. 15710) diluted in PEM buffer (80 mM PIPES, 2 mM MgCl 2 , 5 mM EGTA, pH 6.8). After fixation, depending on the experiment, and as described in the corresponding figure legends, immunocytochemistry was performed. Single-color click chemistry labeling in ND7/23 cells and neurons after fixation Labeling with the cell-impermeable tetrazine dyes ATTO655-me-tz, ATTO488-tz, and AF647-tz was performed after cell fixation. First, the UAA was removed and cells were washed according to the washing procedure used for live-cell labeling. After 2–4 h of washing, the medium was aspirated, and ND7/23 cells were rinsed with PBS and fixed with 4% PFA in 0.1 M PB, whereas neurons were fixed without PBS rinsing with 4% PFA in PEM buffer for 15 min at RT. Cells were permeabilized with 0.1% Triton X-100 (Sigma-Aldrich, cat. no. X-100) in PBS for 10 min at RT. Tetrazine dyes were diluted to a working concentration of 0.5–2.5 µM in PBS. Cells were rinsed with PBS and labeled with dyes for 10 min at 37 °C. After labeling, cells were rinsed three times with PBS and incubated on a shaker at RT for 20–30 min. Afterward, the FLAG tag was labeled by immunocytochemistry. Pulse–chase click chemistry labeling of two NFL populations in neurons Neurons were labeled with the first tetrazine dye (BODIPY-tz) two days after transfection, following the same protocol as for the single-color live click chemistry labeling. After labeling with the first dye, neurons were washed for 2–3 h in a 1:1 mixture of fresh NB Plus + and CM, and then incubated with TCO*A-Lys for a further 3 h or 2 days. After that time, neurons were labeled with the second dye (SiR-tz) following the same protocol as above. Alternatively, after labeling with the first dye, neurons were washed in a 1:1 mixture of fresh NB Plus + and CM for 1 day, and then incubated with TCO*A-Lys for 1 day. Afterward, neurons were washed, labeled with SiR-tz, and fixed immediately after labeling. For the controls of two NFL population labeling, after labeling with the first dye (BODIPY-tz), neurons were either labeled immediately with the second dye (SiR-tz), or incubated without TCO*A-Lys for 2 days, and then labeled with the second dye (SiR-tz). After labeling with the second dye, neurons were either fixed and stained using anti-FLAG immunocytochemistry or imaged live with confocal scanning microscopy. For STED imaging experiments involving labeling of two NFL populations and oxidative injury, we established a slightly different protocol. Two days after transfection, neurons were labeled with SiR-tz by following the same protocol as for the single-color live click chemistry labeling. Then, neurons were washed for 3 h and incubated for 30 min (37 °C, 5% CO 2 ) with either 25 µM spermine-NONOate (a nitric oxide donor; Cayman Chemical, cat. no. 82150) or 25 µM sulpho-NONOate (control compound; Cayman Chemical, cat. no. 83300), in the presence of TCO*A-Lys. After injury, neurons were rinsed with warm NB Plus + and incubated for 2 days with TCO*A-Lys. Then, neurons were fixed and labeled with 1-1.5 µM ATTO488-tz following the fixed-cell labeling protocol described above.

Show full methods section

Cell culture Mouse neuroblastoma × rat neuron hybrid

ND7/23 cells were purchased from Sigma-Aldrich (ECACC 92090903). They were grown in high-glucose Dulbecco’s Modified Eagle Medium (DMEM; ThermoFisher Scientific, cat. no. 41965062) supplemented with 10% heat-inactivated fetal bovine serum (FBS; ThermoFisher Scientific, cat. no. 10270106), 1% penicillin–streptomycin (PS; Sigma-Aldrich, cat. no. P0781), 1% sodium pyruvate (ThermoFisher Scientific, cat. no. 11360039) and 1% l -glutamine (ThermoFisher Scientific, cat. no. 25030024). FBS was inactivated by incubation at 56 °C for 30 min. Cells were passaged three times per week, and used for transfections at passages 3–15. For microscopy experiments, ND7/23 cells were seeded on eight-well Lab-Tek II chambered cover glasses (German #1.5 borosilicate glass; ThermoFisher Scientific, cat. no. 155409) at a density of 25,000 cells per well. Prior to cell seeding, the cover glasses were coated with a 10 µg/ml solution of poly- d -lysine (Sigma-Aldrich, cat. no. P6407) in double-distilled water (ddH 2 O) for a minimum of 4 h at room temperature (RT). Chambered cover glasses were washed three times with ddH 2 O and allowed to dry prior to cell seeding. For lysis and western blot analysis, ND7/23 cells were seeded in 6-well plates (Greiner Bio-One, cat. no. 657160), at a density of 200,000 cells per well. Primary mouse cortical neurons (MCNs) from C57BL/6 embryonic day 17 were purchased from ThermoFisher Scientific (cat. no. A15586). They were thawed and cultured according to the manufacturer’s recommendation in a B-27 Plus Neuronal Culture System consisting of Neurobasal Plus (NB Plus) medium and B27 Plus supplement (ThermoFisher Scientific, cat. no. A3653401). Culturing medium was prepared by adding 2% of B27 Plus supplement and 1% of PS to Neurobasal Plus + (NB Plus +). For widefield and confocal microscopy experiments, MCNs were seeded on eight-well Lab-Tek II chambered cover glasses at a density of 90,000–110,000 cells per well. For experiments that did not require transfection, MCNs were seeded at a density of 70,000 cells per well. For STED imaging, MCNs were seeded on eight-well µ-slides with glass bottoms (Ibidi cat. no. 80827), at a density of 100,000 cells per well. For experiments that involved isolation of neuronal genomic DNA or total RNA, MCNs were seeded in 12-well plates (Corning Incorporated, cat. no. 3512), at a density of 500,000–1 million cells per well. The bottoms of the Lab-Tek chambers, µ-slides, and 12-well plates were pre-coated with a 20 µg/ml solution of poly- d -lysine in ddH 2 O for 2 h at RT. Prior to cell seeding, they were washed three times with ddH 2 O, allowed to dry, and then pre-incubated for at least 30 min with NB Plus + medium. During the culturing of the MCNs, half the NB Plus + medium was exchanged twice per week. Constructs, cloning, and mutagenesis The cDNA encoding for mouse neurofilament light chain (NFL) was amplified from the vector pmNFL (a gift from Anthony Brown, Addgene plasmid #83127; http://n2t.net/addgene:83127 ; RRID: Addgene_83127) 77 and initially cloned in an mEGFP-N1 plasmid (a gift from Michael Davidson, Addgene plasmid #54767; http://n2t.net/addgene:54767 ; RRID: Addgene_54767) using HindIII (ThermoFisher Scientific, cat. no. FD0504) and ApaI (ThermoFisher Scientific, cat. no. FD1414) enzymes. In the resulting construct, the TAG amber stop codon was introduced at positions K211, K363, R438, and K468 of the NFL cDNA, via PCR-based site-directed mutagenesis. After the mutagenesis, GFP was excised from all constructs using the enzymes BamHI (ThermoFisher Scientific, cat. no. FD0054) and NotI (ThermoFisher Scientific, cat. no. FD0595), and replaced by a double-stranded DNA oligonucleotide containing the FLAG tag sequence (DYKDDDDK). The FLAG tag oligonucleotide was synthesized by Sigma-Aldrich as two complementary single-stranded oligonucleotides (Supplementary Table 3 ). FLAG-NFL TAG constructs were cloned by excising the NFL WT -FLAG-encoding sequence from the pCMV backbone and replacing it with the FLAG-NFL TAG -encoding sequence, using the enzymes HindIII and NotI. The DNA encoding FLAG-NFL TAG was amplified by PCR from the NFL TAG -GFP plasmids using the forward primer that contained the FLAG-encoding sequence (Supplementary Table 3 ). FLAG-NFL WT construct was cloned next by using enzymes KpnI (ThermoFisher Scientific, cat. no. FD0524) and PvuI (ThermoFisher Scientific, cat. no. FD0624) to excise the K363TAG-containing DNA fragment from the FLAG-NFL K363TAG construct and replace it with the corresponding WT sequence. Together with NFL, we co-transfected neurofilament medium chain (NFM) cDNA-containing plasmid pmNFM (a gift from Anthony Brown, Addgene plasmid #83126; http://n2t.net/addgene:83126 ; RRID: Addgene_83126) 77 . For the experiments involving amber codon suppression of overexpressed NFL TAG mutants, we used a previously published pcDNA3.1/Zeo(+) plasmid 26 containing a sequence that encodes Methanosarcina mazei pyrrolysyl-tRNA synthetase with a nuclear export signaling sequence and Y306A, Y384F substitutions (NES PylRS AF ), and one copy of tRNA CUA Pyl under the control of the U6 promoter (a kind gift from Edward Lemke’s laboratory, EMBL, Heidelberg, and IMB, Mainz). For the experiments involving amber codon suppression of endogenous NFL and βIII-tubulin, as well as western blot analysis, we used a pcDNA3.1/Zeo(+) plasmid containing codon-optimized sequence that encodes Methanosarcina mazei NES PylRS AF and one copy of tRNA CUA Pyl . The codon-optimized sequence encoding the NES PylRS was synthesized by GenScript and cloned into the pcDNA3.1/Zeo(+) vector. We subsequently added tRNA CUA Pyl and the U6 promoter or the 4xU6-M15tRNA CUA 27 cassette upstream of the CMV promoter in the reverse direction by cloning, using BglII (ThermoFisher Scientific, cat. no. FD0083) and MfeI (ThermoFisher Scientific, cat. no. FD0753) enzymes. The U6 promoter-tRNA cassette synthesized by GenScript or pNEU-hMbPylRS-4xU6M15 plasmid (a gift from Irene Coin, Addgene plasmid #105830; http://n2t.net/addgene:105830 ; RRID:Addgene_105830) 27 were used as a template for the cloning. For the amber codon suppression of endogenous proteins as well as western blot analysis, we also co-transfected cells with eukaryotic release factor 1 E55D mutant (eRF1 E55D ). This plasmid was cloned by Christopher D. Reinkemeier in Edward Lemke’s laboratory. For the labeling of endogenous βIII-tubulin, we used a pORANGE Tubb3-GFP KI plasmid (a gift from Harold MacGillavry, Addgene plasmid #131497; http://n2t.net/addgene:131497 ; RRID: Addgene_131497) 44 . For the optimization of genetic code expansion of endogenous βIII-tubulin, we replaced GFP from this construct with GFP Y39TAG by cloning with HindIII (ThermoFisher Scientific, cat. no. FD0504) and XhoI (ThermoFisher Scientific, cat. no. FD0694) restriction sites. In order to label endogenous NFL, we designed and cloned target and donor sequences following the previously published protocol 44 . The NFL target sequence GAGTGCTGGAGAGGAGCAGG ( https://wge.stemcell.sanger.ac.uk//crispr/377510968 ) was selected using the Ensembl browser 78 [Ensembl release 102, November 2020; Mus musculus version 102.38 (GRCm38.p6), Chromosome 14: 68,087,408–68,087,430] based on available PAM sites at the end of the Nefl gene. The integration site is Q537 and the knock-in results in the deletion of six C-terminal amino acids of the NFL protein. The target sequence was subsequently cloned into the pORANGE cloning template vector (a gift from Harold MacGillavry Addgene plasmid #131471; http://n2t.net/addgene:131471 ; RRID: Addgene_131471) 44 using the BbsI enzyme (ThermoFisher Scientific, cat. no. FD1014) and single-stranded DNA oligonucleotides synthesized by Sigma-Aldrich. In the next step, we cloned a donor sequence containing linker -3xFLAG ( GSAGSA -DYKDHDGDYKDHDIDYKDDDDK) or linker A6TAG -3xFLAG ( GSAGS*- DYKDHDGDYKDHDIDYKDDDDK) into the resulting plasmid (pORANGE NFL KI), using the enzymes HindIII and BamHI. The donor sequences were amplified by PCR from existing plasmids. For labeling of the endogenous NFL via Targeted Knock-In with Two guides approach (TKIT) 46 we selected two target sequences in the Nefl gene, using the Ensembl browser 78 . First target sequence (gRNA1; https://wge.stemcell.sanger.ac.uk//crispr/377510942 ) is located in the last intron (intron 3) of Nefl gene, 114 bp upstream of the start of the last exon (exon 4). Second target sequence (gRNA2; https://wge.stemcell.sanger.ac.uk//crispr/377510985 ) is located in the 3′ untranslated region (UTR) of the Nefl gene, 107 bp downstream of the STOP codon. Both target sequences were synthetized by Sigma-Aldrich as single-stranded DNA oligonucleotides and were separately cloned into the pORANGE cloning template vector using the BbsI enzyme. The plasmid containing gRNA2 was subsequently used as a template for PCR amplification of the U6 promoter-gRNA2 cassette, which was then cloned in the multiple cloning site of the plasmid containing gRNA1, using enzymes XbaI (ThermoFisher Scientific, cat. no. FD0684) and SalI (ThermoFisher Scientific, cat. no. FD0644). The resulting construct contains U6 promoter-gRNA1 followed by U6 promoter-gRNA2 as well as spCas9 expressed from the CAG promoter. Donor sequences for TKIT knock-in were synthetized by Eurofins Genomics and contain the following sequences: reverse complement sequence of gRNA2 followed by a part of Nefl intron 3, whole Nefl exon 4 with the addition of linker WT -3xFLAG sequence or linker A6TAG -3xFLAG sequence, a part of the 3′ UTR and a reverse complement sequence of gRNA1. Subsequently, both WT- and A6TAG-linker-containing donor sequences were cloned upstream of the CMV promoter in the pcDNA3.1/Zeo(+) and in the pcDNA3.1/Zeo(+)-mCherry vectors. For the experiments involving the combination of TKIT-based knock-in and amber codon suppression, pcDNA3.1/Zeo(+) vector containing tRNA CUA Pyl and codon-optimized sequence encoding NES PylRS AF was modified to include internal ribosomal entry site (IRES) followed by eRF1 E55D -encoding sequence. All primer and oligonucleotide sequences used for cloning and mutagenesis are listed in Supplementary Table 3 . Donor sequences for ORANGE- and TKIT-based knock-in and primers used for PCR amplification and sequencing of genomic DNA and cDNA are listed in Supplementary Table 4 . UAAs, tetrazine derivatives of fluorescent dyes, and antibodies In this study, the following unnatural amino acids (UAAs) were used: trans -cyclooct-2-en- l -lysine (TCO*A-Lys; Sirius Fine Chemicals, SICHEM, cat. no. SC-8008), trans -cyclooct-4-en- l -lysine (TCO4en/eq-Lys; a kind gift from Edward Lemke’s laboratory, also available from SICHEM, cat. no. SC-8060) and endo -bicyclo[6.1.0]nonyne-lysine (endo-BCN-Lys; SICHEM cat. no. SC-8014). For SPIEDAC labeling, the following tetrazine derivatives of fluorescent dyes were used: ATTO655-methyltetrazine (ATTO655-me-tz; ATTO-TEC GmbH, cat. no. AD 655-2502), ATTO488-tetrazine (ATTO488-tz; Jena Bioscience, cat. no. CLK-010-02), CF500-methyltetrazine (CF500-me-tz; Biotium cat. no. 96029), CF650-methyltetrazine (CF650-me-tz; Biotium cat. no. 96036), Janelia Fluor 646-methyltetrazine (JF646-me-tz; Jena Bioscience custom synthesis), Janelia Fluor 549-tetrazine (JF549-tz; Tocris cat. no. 6502), silicon rhodamine-tetrazine (SiR-tz; SpiroChrome cat. no. SC008), Alexa Fluor 647-tetrazine (AF647-tz; a kind gift from Edward Lemke’s laboratory), TAMRA-tetrazine (TAMRA-tz; Jena Bioscience cat. no. CLK-017-05), and BODIPY-tetrazine (BODIPY-tz; Jena Bioscience cat. no. CLK-036-05). For immunocytochemistry and western blot, the following antibodies were used: rabbit anti-FLAG antibody (Merck Millipore cat. no. F7425), mouse anti-FLAG M2 antibody (Sigma-Aldrich, cat.no. F1804), mouse anti-neurofilament 70 kDa antibody, clone DA2 (Merck Millipore cat. no. MAB1615), mouse anti-βIII-tubulin antibody (BioLegend, cat. no. 801202), goat anti-rabbit Alexa Fluor (AF) 488 Plus (ThermoFisher Scientific, cat. no. A32731), goat anti-rabbit AF555 (ThermoFisher Scientific, cat. no. A21429), goat anti-mouse AF555 (ThermoFisher Scientific, cat. no. A21424), goat anti-rabbit AF647 Plus (ThermoFisher Scientific, cat. no. A32733), goat anti-mouse AF488 Plus (ThermoFisher Scientific, cat. no. A32723), goat anti-mouse AF647 Plus (ThermoFisher Scientific, cat. no. A32728), goat anti-rabbit horseradish peroxidase (HRP; ThermoFisher Scientific, cat. no. A16104), and goat anti-mouse HRP (ThermoFisher Scientific, cat. no. A16072). Transfections Both ND7/23 cells and MCNs were transfected using the Lipofectamine 2000 transfection reagent (ThermoFisher Scientific, cat. no. 11668027). ND7/23 cells were transfected 14–20 h after seeding into an eight-well Lab-Tek chambered slide, with a slightly modified manufacturer’s protocol using a DNA/Lipofectamine 2000 ratio of 1 µg:2.4 µl and up to 0.625 µg of total DNA per well. Immediately after transfection, a stock solution of UAA (100 mM in 0.2 M NaOH containing 15% DMSO) was diluted 1:4 in 1 M HEPES (ThermoFisher Scientific, cat. no. 15630080) and added to cells to a final concentration of 250 µM for TCO*A-Lys and TCO4en/eq-Lys, and 1 mM for endo-BCN-Lys. The medium was replaced after incubation for 6 h (37 °C, 5% CO 2 ), and the HEPES-diluted UAA was again added before cells were incubated overnight (37 °C, 5% CO 2 ). For the transfection of MCNs, we adapted a previously published protocol 79 using Lipofectamine 2000. As was done for ND7/23 cells, we used a DNA/Lipofectamine 2000 ratio of 1 µg:2.4 µl. The total amount of DNA per well in an eight-well Lab-Tek chambered slide was up to 1.25 µg. DNA and Lipofectamine 2000 solutions were prepared in NB Plus medium with 1% of PS. Prior to their addition to the cells, transfection solutions were mixed with an equal volume of warm NB Plus medium containing 4% B27 Plus to obtain a final B27 Plus content of 2%. These final transfection mixtures were then warmed by incubation for 5 min (37 °C, 5% CO 2 ). The culturing medium was aspirated from neurons and retained for use as conditioned medium (CM), and warm transfection mixture was added dropwise to cells. After incubation for 4–6 h, the transfection medium was aspirated, and the retained CM was added back to cells. If the transfection was performed on the day of medium change, half the volume of CM was put back to the cells and topped up with fresh NB Plus + medium. Afterward, 100 mM TCO*A-Lys, endo-BCN-Lys or TCO4en/eq-Lys stock (in 0.2 M NaOH containing 15% DMSO) was diluted 1:4 in 1 M HEPES and added to neurons, to a final concentration of 250 µM. MCNs were incubated (37 °C, 5% CO 2 ) for a minimum of two days prior to click labeling. The exact labeling time points are described in figure legends. For NFL TAG overexpression experiments, MCNs were transfected at day in vitro (DIV) 8, and for the labeling of endogenous NFL with pORANGE or TKIT vectors, MCNs were transfected at DIV5. For the labeling of endogenous βIII-tubulin with pORANGE vectors, MCNs were transfected at DIV3. For lysis and western blot analysis, ND7/23 cells were transfected 14–20 h after seeding in 6-well plates using the Lipofectamine 2000 transfection reagent. DNA/Lipofectamine 2000 ratio was 1 µg:2.4 µl and the total DNA amount was 5.25 µg/well. Alternatively, cells were transfected using the calcium phosphate method. Briefly, per well of a 6-well plate, 25 µl of 1 M calcium chloride (Sigma-Aldrich, cat. no. C5670) was mixed with 5.25 µg of DNA, and sterile water was added up to 100 µl. This mixture was added dropwise to 100 µl of 2× HBS (50 mM HEPES, 280 mM NaCl, 1.5 mM Na 2 HPO 4 , pH 7), slowly, while flicking the tube to mix the solutions. After 10 min of incubation, transfection mixtures were added dropwise to cells. Immediately after transfection, a stock solution of TCO*A-Lys (100 mM in 0.2 M NaOH containing 15% DMSO) was diluted 1:4 in 1 M HEPES and added to cells to a final concentration of 250 µM. The medium was replaced after incubation for 6 h (37 °C, 5% CO 2 ), and the HEPES-diluted TCO*A-Lys was again added before cells were incubated overnight (37 °C, 5% CO 2 ). Single-color click chemistry labeling in live ND7/23 cells and neurons with cell-permeable dyes ND7/23 cells expressing NFL WT -FLAG or NFL TAG -FLAG mutants were labeled by SPIEDAC click chemistry after overnight (18-20 h) incubation with the UAA. To wash out excess UAA, medium containing the UAA was removed, cells were washed twice with culturing medium and then incubated 2 h in a fresh culturing medium. Cells were washed once more with culturing medium and incubated for 10 min (37 °C, 5% CO 2 ) with the tetrazine dye diluted in culturing medium. The concentration of tetrazine dyes was 5 µM, except for JF549-tz, which was used at a concentration of 2.5 µM. After incubation for 10 min, the dye-containing medium was aspirated, cells were washed twice and then incubated for 2 h in fresh culturing medium. Afterward, the culturing medium was aspirated, cells were washed once with 0.01 M phosphate-buffered saline (PBS; 137 mM NaCl, 10 mM Na 2 HPO 4 , 1.8 mM KH 2 PO 4 , 2.7 mM KCl, pH 7.4) and fixed with 4% paraformaldehyde (PFA; Sigma-Aldrich, cat. no. 158127) in 0.1 M phosphate buffer (PB) for 15 min at RT. After fixation, the FLAG tag was labeled by immunocytochemistry. Live-cell click chemistry labeling of MCNs was performed 2–3 days (overexpression experiments) or 6 days (labeling of endogenous NFL with pORANGE or TKIT vectors) after transfection. First, medium containing the UAA was removed, neurons were washed twice with fresh NB Plus +, and then incubated for 2–3 h (37 °C, 5 % CO 2 ) in a 1:1 mixture of fresh NB Plus + and CM (collected either on the day of transfection, or from neurons cultured only for this purpose). Afterward, neurons were washed once more with fresh NB Plus + and incubated with the tetrazine dye diluted in fresh NB Plus + for 10 min (37 °C, 5% CO 2 ). The concentrations of dyes were the same as for the labeling in ND7/23 cells. After the labeling period, neurons were washed twice with fresh NB Plus + and incubated for 2–3 h in a 1:1 mixture of fresh NB Plus + and CM. For the click chemistry labeling background measurements, neurons were incubated either 2 h or 10 h after the labeling. The culturing medium was then aspirated, and neurons were fixed with 4% electron microscopy grade PFA (Electron Microscopy Sciences, cat. no. 15710) diluted in PEM buffer (80 mM PIPES, 2 mM MgCl 2 , 5 mM EGTA, pH 6.8). After fixation, depending on the experiment, and as described in the corresponding figure legends, immunocytochemistry was performed. Single-color click chemistry labeling in ND7/23 cells and neurons after fixation Labeling with the cell-impermeable tetrazine dyes ATTO655-me-tz, ATTO488-tz, and AF647-tz was performed after cell fixation. First, the UAA was removed and cells were washed according to the washing procedure used for live-cell labeling. After 2–4 h of washing, the medium was aspirated, and ND7/23 cells were rinsed with PBS and fixed with 4% PFA in 0.1 M PB, whereas neurons were fixed without PBS rinsing with 4% PFA in PEM buffer for 15 min at RT. Cells were permeabilized with 0.1% Triton X-100 (Sigma-Aldrich, cat. no. X-100) in PBS for 10 min at RT. Tetrazine dyes were diluted to a working concentration of 0.5–2.5 µM in PBS. Cells were rinsed with PBS and labeled with dyes for 10 min at 37 °C. After labeling, cells were rinsed three times with PBS and incubated on a shaker at RT for 20–30 min. Afterward, the FLAG tag was labeled by immunocytochemistry. Pulse–chase click chemistry labeling of two NFL populations in neurons Neurons were labeled with the first tetrazine dye (BODIPY-tz) two days after transfection, following the same protocol as for the single-color live click chemistry labeling. After labeling with the first dye, neurons were washed for 2–3 h in a 1:1 mixture of fresh NB Plus + and CM, and then incubated with TCO*A-Lys for a further 3 h or 2 days. After that time, neurons were labeled with the second dye (SiR-tz) following the same protocol as above. Alternatively, after labeling with the first dye, neurons were washed in a 1:1 mixture of fresh NB Plus + and CM for 1 day, and then incubated with TCO*A-Lys for 1 day. Afterward, neurons were washed, labeled with SiR-tz, and fixed immediately after labeling. For the controls of two NFL population labeling, after labeling with the first dye (BODIPY-tz), neurons were either labeled immediately with the second dye (SiR-tz), or incubated without TCO*A-Lys for 2 days, and then labeled with the second dye (SiR-tz). After labeling with the second dye, neurons were either fixed and stained using anti-FLAG immunocytochemistry or imaged live with confocal scanning microscopy. For STED imaging experiments involving labeling of two NFL populations and oxidative injury, we established a slightly different protocol. Two days after transfection, neurons were labeled with SiR-tz by following the same protocol as for the single-color live click chemistry labeling. Then, neurons were washed for 3 h and incubated for 30 min (37 °C, 5% CO 2 ) with either 25 µM spermine-NONOate (a nitric oxide donor; Cayman Chemical, cat. no. 82150) or 25 µM sulpho-NONOate (control compound; Cayman Chemical, cat. no. 83300), in the presence of TCO*A-Lys. After injury, neurons were rinsed with warm NB Plus + and incubated for 2 days with TCO*A-Lys. Then, neurons were fixed and labeled with 1-1.5 µM ATTO488-tz following the fixed-cell labeling protocol described above.

MitoTracker and LysoTracker labeling

For the experiments with MitoTracker and LysoTracker labeling, neurons were transfected and labeled with SiR-tz as described above. After washing for 2–3 h, 250 µl of NB Plus + medium containing 100 nM MitoTracker Orange (ThermoFisher Scientific, cat. no. M7510) and 400 nM LysoTracker Green (Cell Signaling Technology, cat. no. 8783 S) was added to the wells that already contained 250 µl of medium, for final concentrations of 50 and 200 nM for MitoTracker and LysoTracker, respectively. For the additional control experiments (data shown in Supplementary Fig. 9 ) involving tetrazine-dye and LysoTracker labeling, MCNs were seeded at a density of 70,000 cells per well and were not transfected. At DIV8, HEPES-diluted TCO*A-Lys was added to cells at a concentration of 250 µM. After 3 days of incubation with TCO*A-Lys, MCNs were labeled with either BODIPY-tz or SiR-tz, washed for 3 h, and then labeled as described above with 200 nM of either LysoTracker Green or LysoTracker Deep Red (ThermoFisher Scientific, cat. no. L12492 ). Neurons were incubated with MitoTracker and LysoTracker dyes for 30 min and rinsed twice with NB Plus +. Immediately afterward, NB Plus + was replaced by Hibernate E medium (Brain Bits LLC, cat. no. HELF) containing 1% PS and 2% B27 Plus, and neurons were imaged live with confocal scanning microscopy.

Immunocytochemistry staining

For anti-NFL and anti-FLAG immunocytochemical staining, cells and neurons were fixed as described above, then washed three times (5 min each wash) with PBS. Afterward, cells were incubated for 1 h at RT with a blocking serum containing 3% bovine serum albumin (BSA; Sigma-Aldrich, cat. no. A9647), 10% goat serum (GS; ThermoFisher Scientific, cat. no. 16210072), and 0.2% Triton X-100 diluted in PBS. For ORANGE and TKIT knock-in efficiency experiments, cells were first permeabilized with 0.1% Triton X-100 for 10 min at RT, briefly washed, and blocked with 3% BSA, 10% GS solution in PBS for 1 h at RT. Primary and secondary antibodies were diluted in the corresponding blocking serum (with or without 0.2% Triton X-100). Rabbit anti-FLAG antibody was used at a dilution of either 1:1000 (overexpression experiments) or 1:2000 (endogenous NFL labeling experiments with pORANGE/TKIT vectors), while mouse anti-FLAG M2 antibody was used at a dilution of 1:2000. Mouse anti-NFL antibody and all secondary antibodies were used at a dilution of 1:500. Cells were incubated with primary antibodies either overnight at 4 °C or for 1 h at RT, then washed three times (5 min each wash) with PBS and incubated for 1 h at RT with the secondary antibodies. Afterward, cells were washed three times (5 min each wash) with PBS and either imaged immediately, or stored at 4 °C until imaging.

Cell lysis and western blot analysis

One day after the transfection, ND7/23 cells were collected from 6-well plates and lysed using RIPA buffer (12.5 mM Tris hydrochloride, 37 mM NaCl, 3 mM sodium deoxycholate, pH 8) containing 1:50 protease inhibitor cocktail (Sigma-Aldrich, cat. no. P8340), 1 mM phenylmethanesulfonyl fluoride (Sigma-Aldrich, cat. no. P7626), and 50 mM sodium fluoride (Sigma-Aldrich, cat. no. S7920). Alternatively, cells were lysed with RIPA buffer containing 1:100 Halt™ Protease and Phosphatase Inhibitor Cocktail (ThermoFisher Scientific, cat. no. 78440) and 1 mM phenylmethanesulfonyl fluoride. Cells were incubated with the lysis buffer for 40 min on ice, then centrifuged at 4 °C for 30 min at 18,000× g . Protein-containing supernatants were transferred into clean tubes and protein concentration was measured using the Bradford reagent (Sigma-Aldrich, cat. no. B6916). For SDS-PAGE electrophoresis, samples were mixed with Laemmli buffer (BioRad, cat. no. 1610747) and denatured for 5 min at 95 °C. Samples were loaded on NuPAGE™ 4-12% Bis-Tris Protein Gels (ThermoFisher Scientific, NP0329), 20 μg of protein/well. Electrophoresis was performed in 1× MOPS buffer (ThermoFisher Scientific, cat. no. NP0001) for 1 h at 150 V. After electrophoresis, proteins were transferred to a 0.2 μm nitrocellulose membranes (BioRad, cat. no. 1704158) by semi-dry Trans Blot Turbo transfer (BioRad, cat. no. 1704150), 7 min at 25 V and 2.5 A. Membranes were then stained with Ponceau S solution, imaged, and washed in water. Afterward, membranes were blocked for 1 h at RT in 5% milk (w/v) in TBS buffer (Tris-buffered saline; 20 mM Tris, 150 mM NaCl, pH 7.6) containing 0.05% Tween 20 (TBS-T; Sigma-Aldrich, cat. no. P7949). After blocking, membranes were incubated with primary antibodies diluted 1:5000 in 3% BSA in TBS-T for 1 h at RT on a rotating shaker. Primary antibodies were washed three times in TBS-T, 5 min each wash. Membranes were incubated with HRP-conjugated secondary antibodies, diluted 1:5000 in 3% BSA in TBS-T for 1 h at RT on a rotating shaker. Secondary antibodies were washed two times in TBS-T, each wash 5 min, and once with TBS before addition of Clarity Western ECL substrate (BioRad, cat. no. 1705060). Chemiluminescence was visualized using Azure 600 imager (Azure Biosystems). For the samples containing NFL-FLAG, membranes were first stained with anti-FLAG antibody, imaged, subsequently stained with anti-βIII-tubulin antibody, and imaged again. Before anti-βIII-tubulin labeling of FLAG-NFL-containing samples, membranes were stripped by incubating two times for 10 min in the stripping buffer (200 mM glycine, 3.5 mM sodium dodecyl sulfate, 1% Tween 20, pH 2.2). Membranes were then washed two times with TBS, each wash 5 minutes, and two times with TBS-T, each wash 10 min. After the stripping, membranes were blocked and labeled with primary (1:5000 dilution) and secondary antibodies (1:5000 dilution) as described above. Western blot analysis was done using AzureSpot software (Azure Biosystems). Total volume of anti-FLAG bands was measured automatically and normalized to the volume of corresponding tubulin βIII bands, which served as a loading control. The percentages of full-length and truncated FLAG-NFL TAG were calculated automatically as band percentage in AzureSpot. Data were collected from three independent experiments, and are shown as average percentages, with the corresponding SEM values in Supplementary Fig. 2 . Supplementary Tables 1 and 2 contain the full data sets that were used for the analysis. Uncropped scans of the blots are provided at the end of the Supplementary Information. Raw images are provided on Figshare under following 10.6084/m9.figshare.c.5749409 80 . Quantification of CRISPR/Cas9 knock-in efficiency For the quantification of ORANGE-mediated knock-in efficiency, MCNs were transfected at DIV5 with a 1:1 ratio of pORANGE NFL linker WT -3xFLAG KI and pcDNA3.1/Zeo(+)-mCherry constructs. MCNs were fixed with 4% PFA in PEM buffer 24 h, 72 h, and 144 h after transfection, stained with mouse anti-FLAG antibody, and imaged with widefield microscopy. Transfected cells were identified based on their mCherry signal and counted as knock-in positive or negative based on the presence or absence of the FLAG signal. 534 mCherry + cells per time point were collected from three experiments. For the quantification of TKIT-mediated knock-in efficiency, MCNs were transfected at DIV5 with a 1:1 ratio of a plasmid containing gRNA1, gRNA2, and spCas9, and with pcDNA3.1/Zeo(+)-mCherry plasmid containing the linker WT -3xFLAG donor sequence. After 144 h, MCNs were fixed, immunostained, and imaged in the same way as for the ORANGE knock-in efficiency experiments. 600 mCherry + cells were collected from two experiments.

Assessment of ORANGE knock-in specificity

For the assessment of ORANGE-mediated knock-in specificity, MCNs were transfected at DIV5 with pORANGE NFL linker WT -3xFLAG KI plasmid and incubated for 4 days. Genomic DNA was extracted using the PureLink Genomic DNA mini kit (ThermoFisher Scientific, cat. no. K182001) and used as a template for touchdown PCR with primers amplifying 5′ and 3′ junction of the integrated donor sequence. PCR products were separated on 1% agarose gel, extracted using PureLink Quick Gel Extraction Kit (ThermoFisher Scientific, cat. no. K210012), and sequenced (LGC Genomics GmbH, Germany). Correct insertion of the donor sequence was confirmed by sequence analysis, using the Vector NTI Advance software (Life Technologies). Primers used for touchdown PCR and sequencing are listed in Supplementary Table 4 .

Analysis of Nefl mRNA after TKIT-mediated knock-in

For the analysis of proper Nefl mRNA splicing after TKIT-mediated knock-in, MCNs were transfected at DIV5 with a 1:1 ratio of a plasmid containing gRNA1, gRNA2, and spCas9, and with pcDNA3.1/Zeo(+) plasmid containing the linker WT -3xFLAG donor sequence. After 144 h, total RNA was isolated from neurons using RNAqueous Micro Total RNA Isolation Kit (ThermoFisher Scientific, cat. no. AM1931). Total RNA was then used as a template for cDNA synthesis using the oligo-dT primer and a SuperScript™ IV First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18091150). Resulting cDNA was amplified by PCR, using the primers that flank the splice junction between Nefl exons 3 and 4, and primers that flank the 3′ junction of the integrated donor sequence. PCR products were then separated on 1% agarose gel, extracted using PureLink Quick Gel Extraction Kit (ThermoFisher Scientific, cat. no. K210012), and sequenced (LGC Genomics). Sequence analysis showed that the donor sequence is correctly integrated in the Nefl gene and that splicing between exons 3 and 4 is unaffected by the donor sequence integration. Primers used for PCR and sequencing are listed in Supplementary Table 4 .

Widefield imaging

Widefield epifluorescence imaging was performed on an inverted Nikon Eclipse Ti2-E microscope (Nikon Instruments), equipped with XY-motorized stage, Perfect Focus System, and an oil-immersion objective (Apo 60×, NA 1.4, oil). Setup was controlled by NIS-Elements AR software (Nikon Instruments). Fluorescent light was filtered through 488 (AHF; EX 482/18; DM R488; BA 525/45), 561 (AHF; EX 561/14; DM R561; BA 609/54), and Cy5 (AHF; EX 628/40; DM660; BA 692/40) filter cubes. A fluorescent lamp (Lumencor Sola SE II) was used as a light source and emitted light was imaged with ORCA-Flash 4.0 sCMOS camera (Hamamatsu Photonics). Images were acquired at 16-bit depth, 1024 × 1024 pixels, and pixel size 0.27 µm.

Confocal imaging of fixed and live cells

Confocal imaging was performed on an LSM 710 confocal scanning microscope (Zeiss, Oberkochen, Germany), controlled by ZEN 2011 (Zeiss) software, equipped with a Plan-Apochromat 63× objective (NA 1.4, oil), 488, 561 and 633 nm laser lines, and continuous spectral detection. Images were acquired at 16-bit depth, 1024 × 1024 pixels, pixel size 0.132 µm, with 2× line averaging and a pixel dwell time of 6.3 µs, either as a single plane or as a Z -stack with 0.37 µm step size. In all channels, pinhole was set to 1 Airy unit. Emission light was collected sequentially, according to the emission spectra of the fluorophores used. For the live-cell imaging, a temperature module was used and cells were placed in a heating insert (PeCon, Erbach Germany), which had been equilibrated to 37 °C. The medium used for imaging was Hibernate E medium containing 1% PS and 2% B27 Plus. STED imaging Super-resolution STED imaging was performed on a Leica TCS SP8 microscope (Leica Microsystems IR GmbH, Germany), using an HC PL APO CS2 100×/1.4 oil objective, hybrid detectors, and the following laser lines: 488 and 635 nm pulsed excitation lasers, as well as continuous 592 nm and gated pulsed 775 nm depletion lasers. Setup is controlled by LAS X (Leica) software. Excitation laser power and detector gain were adjusted for each image individually by avoiding over-saturation, according to the high and low pixel values. Emission light was collected sequentially, according to the emission spectra of the fluorophores used, for example, 500–580 nm (for ATTO488, AF488) or 645–760 nm (for SiR, CF650). Depletion lasers were used at 35–45% of maximum power. Images were acquired at 8-bit depth, image size 2048 × 2048 pixels, and pixel size 13-14 nm. For the confocal imaging, line averaging was 3× and frame accumulation 3×, whereas for STED imaging frame averaging was from 2 to 4×, and line accumulation 4×.

Image processing

Raw images were processed in Fiji software 81 . Widefield images were processed by linear adjustment of brightness and contrast and saved as TIFF files. Confocal Z- stack images were converted into maximum intensity projections, the brightness and contrast were adjusted linearly, and images were saved as TIFF files. Colocalization analysis of anti-FLAG, anti-NFL and click chemistry SiR-tz labeled NFL was performed using the EzColocalization plugin for Fiji 82 . Full 16-bit images were imported in Fiji and cropped to contain only the region of interest (ROI). Each ROI is outlined by a dashed box in the corresponding figures. Fluorescently labeled regions were identified with automatic default thresholding, and analyzed using the Costes’ algorithm for the calculation of Pearson’s correlation coefficient. Colocalization data were visualized as cell pixel intensity scatterplots, xy coordinates were exported to Microsoft Excel and used for the generation of scatterplots. Scatterplots were further imported in Adobe Illustrator for the final presentation in figures. STED images and the corresponding confocal images were deconvolved using Huygens deconvolution software (SVI, Netherlands), using Classical Maximum Likelihood Estimation (CMLE) algorithm. The signal-to-noise ratio was set to 20 for confocal and to 7 for STED images, and the maximum number of iterations was 40. Background levels (Supplementary Table 5 ) were chosen by manually checking the background of each image. After deconvolution, images were imported in Fiji, adjusted linearly for brightness and contrast, and saved as TIFF files. For presentation purposes, all images were converted to 8-bit depth using Fiji and arranged into figures using Adobe Illustrator. The schemes presented in the manuscript were made using the BioRender app (BioRender.com) and Adobe Illustrator.

Click chemistry labeling background intensity measurements

For the intensity measurements of click chemistry labeling background (data shown in Supplementary Fig. 10 ), images were acquired on the confocal microscope described above. Data were collected from three independent experiments, 30 images were acquired and analyzed per condition, a total of 180 images for SiR-tz and 180 images for BODIPY-tz labeling. Full 16-bit range images were imported in Fiji, and the background intensity was measured by placing a rectangular ROI in the cell. ROI was placed in the cytoplasm, between neurofilaments, avoiding the nucleus. One ROI was selected per image. Additionally, imaging background was measured by placing the same ROI in the region of the image that contained no cells. Analysis was done blindly, to avoid bias. Parameters measured in ROIs were area, mean intensity, integrated density, and raw integrated density. Raw integrated density was used for calculation of the corrected total cell fluorescence [CTCF = Raw integrated density − (area × mean fluorescence of the imaging background)]. CTCF values were used for the comparison of background values between the conditions. Analysis of the click labeling background in the presence or absence of eRF1 E55D (data shown in Supplementary Fig. 16b, c ) was done following the same procedure. Transfected cells were identified based on the positive mCherry signal and intensity measurements were done in SiR-tz click labeling channel. A total of 323 images were collected from three independent experiments. Number of cells per group was 96 for NES PylRS/tRNA + eRF1 E55D + TCO*A-Lys; 58 for NES PylRS/tRNA + eRF1 E55D ; 84 for NES PylRS/tRNA + TCO*A-Lys; 54 for NES PylRS/tRNA; 30 for Non-transfected control + TCO*A-Lys.

Statistics Statistical analyses

(Kolmogorov–Smirnov normality test, Kruskal–Wallis test, Mann–Whitney U test, box plots) for background quantifications (data shown in Supplementary Figs. 10 and 16) were carried out with IBM SPSS Statistics Version 25, Armonk, New York, USA. A Kolmogorov–Smirnov test indicated that the data do not follow a normal distribution. Therefore, non-parametric Kruskal–Wallis test was performed. This was followed by a pairwise comparison of groups with Mann–Whitney U tests (with Bonferroni correction for multiple comparisons). Detailed results (mean ranks, U , z, and p values) of these comparisons are shown in Supplementary Tables 6 , 7 , and 8 . Protocol exchange A detailed protocol regarding transfections and click chemistry-based labeling of ND7/23 cells and living primary neurons can be accessed here: 10.21203/rs.3.pex-1727/v1 83 . Reporting summary Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Protocol exchange A detailed protocol regarding transfections and click chemistry-based labeling of ND7/23 cells and living primary neurons can be accessed here: 10.21203/rs.3.pex-1727/v1 83 .

Supplementary information Supplementary Information Reporting Summary Peer Review File

📊 Figures

Fig. 1

Genetic code expansion and click labeling of neurofilament light chain (NFL) in ND7/23 neuroblastoma cells.

a A schematic representation of genetic code expansion and labeling of proteins by click chemistry. Cells are transfected with plasmids bearing genes that encode for NES PylRS (a pyrrolysyl-tRNA synth...

Fig. 2

Genetic code expansion and click labeling of NFL in live primary mouse cortical neurons (MCNs).

a , c MCNs expressing NFL K363TAG -FLAG, NFM and NES PylRS/tRNA CUA Pyl in the presence of TCO*A-Lys. a Three days after transfection, neurons were labeled with SiR-tz via click chemistry, then fixed ...

Fig. 3

Pulseu2013chase click labeling of two NFL populations in live primary mouse cortical neurons (MCNs).

a A schematic representation of the experimental workflow. Eight days after plating, MCNs were transfected with NFL K363TAG -FLAG, NFM, and NES PylRS/tRNA CUA Pyl constructs. After 2 days of incubatio...

Fig. 4

Modified pulseu2013chase click labeling approach reveals two spatially separated NFL populations in cortical neurons (MCNs).

a A schematic representation of the modified experimental workflow. Eight days after plating, MCNs were transfected with NFL K363TAG -FLAG, NFM, and NES PylRS/tRNA CUA Pyl constructs. After 2 days of ...

Fig. 5

Super-resolution stimulated emission depletion (STED) imaging of click-labeled NFL in primary mouse neurons (MCNs).

MCNs expressing NFL K363TAG -FLAG, NFM, and NES PylRS/tRNA CUA Pyl in the presence of TCO*A-Lys. a u2013 c Two to three days after transfection, neurons were labeled with SiR-tz, fixed, and stained wi...

Fig. 6

Click labeling of endogenous NFL in primary mouse neurons (MCNs).

a u2013 c A schematic representation of the tagging of endogenous NFL. a MCNs were transfected with a pORANGE plasmid encoding for spCas9 and gRNA, and containing linker-3xFLAG or linker A6TAG -3xFLAG...

Figure images are served from the NIH/NLM PubMed Central Open Access Subset or Europe PMC; copyright remains with the publishers and authors.

🏛️ Imaging Facility

🏛️ University of Tübingen

💬 Discussion

0 comments

No comments yet. Be the first to start a discussion!

Leave a Comment

MicroHub Assistant