Abstract
The nuclear pore complex (NPC) mediates nucleocytoplasmic transport through the nuclear envelope. How the NPC assembles into this double membrane boundary has remained enigmatic. Here, we captured temporally staged assembly intermediates by correlating live cell imaging with high-resolution electron tomography and super-resolution microscopy. Intermediates were dome-shaped evaginations of the inner nuclear membrane (INM), that grew in diameter and depth until they fused with the flat outer nuclear membrane. Live and super-resolved fluorescence microscopy revealed the molecular maturation of the intermediates, which initially contained the nuclear and cytoplasmic ring component Nup107, and only later the cytoplasmic filament component Nup358. EM particle averaging showed that the evagination base was surrounded by an 8-fold rotationally symmetric ring structure from the beginning and that a growing mushroom-shaped density was continuously associated with the deforming membrane. Quantitative structural analysis revealed that interphase NPC assembly proceeds by an asymmetric inside-out extrusion of the INM.
🔬 Techniques
🔭 Microscopes
💻 Software
✨ Fluorophores
🧪 Sample Preparation
🔬 Cell Lines
🏭 Microscope Brands
🧪 Reagent Suppliers
📷 Detectors
🔎 Objectives
💻 Software Details
📋 Protocols
💾 Data Repositories
🏷️ Research Resource Identifiers (RRIDs)
Verified research resources used in this paper:
🏛️ Research Organizations (ROR)
Affiliated research institutions:
📋 Methods
Cell culture Wildtype
HeLa kyoto cell line was from Prof. Narumiya in Kyoto University (RRID: CVCL_1922 ), and the genome was sequenced previously ( Landry et al., 2013 ). Wildtype NRK (RRID: CVCL_3758 ) and U2OS (RRID: CVCL_0042 ) cell lines were purchased from ATCC (Wesel, Germany). HeLa and NRK cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM) (Sigma Aldrich, St. Louis, MO) supplemented with 10% fetal calf serum (FCS), 2 mM glutamine, 1 mM sodium pyruvate, and 100 µg/ml penicillin and streptomycin. U2OS cells were grown in McCoy's 5A Medium (Sigma Aldrich) supplemented with 10% fetal calf serum (FCS), 1X non-essential amino acids solution (Gibco, Waltham, MA), 5 mM glutamine, 1 mM sodium pyruvate, and 100 µg/ml penicillin and streptomycin. A plasmid carrying Lap-2α fused with YFP ( Dechat et al., 2004 ) was introduced into HeLa cells with the transfection reagent, Fugene6 (Promega, Madison, WI), according to the manufacturer’s protocol. A HeLa cell line stably expressing histone H2b-mCherry ( Neumann et al., 2010 ) was maintained at 500 ng/ml puromycin (Invitrogen, Carlsbad, CA). The mycoplasma contamination was tested by PCR every 2 or 3 months and was always negative. Cells were cultured on 2-well Lab-Tek Chambered Coverglass (Thermo Fisher Scientific, Waltham, MA) for live-cell imaging. For correlative light–electron microscopy, cells were grown on sapphire disks (0.05 mm thick, 3 mm diameter; Wohlwend GmbH, Sennwald, Switzerland), which had been carbon-coated in order to relocate cells on electron microscopy (EM) grids, and synchronized by double thymidine arrest ( Harper, 2005 ).
Show full methods section
Cell culture Wildtype
HeLa kyoto cell line was from Prof. Narumiya in Kyoto University (RRID: CVCL_1922 ), and the genome was sequenced previously ( Landry et al., 2013 ). Wildtype NRK (RRID: CVCL_3758 ) and U2OS (RRID: CVCL_0042 ) cell lines were purchased from ATCC (Wesel, Germany). HeLa and NRK cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM) (Sigma Aldrich, St. Louis, MO) supplemented with 10% fetal calf serum (FCS), 2 mM glutamine, 1 mM sodium pyruvate, and 100 µg/ml penicillin and streptomycin. U2OS cells were grown in McCoy's 5A Medium (Sigma Aldrich) supplemented with 10% fetal calf serum (FCS), 1X non-essential amino acids solution (Gibco, Waltham, MA), 5 mM glutamine, 1 mM sodium pyruvate, and 100 µg/ml penicillin and streptomycin. A plasmid carrying Lap-2α fused with YFP ( Dechat et al., 2004 ) was introduced into HeLa cells with the transfection reagent, Fugene6 (Promega, Madison, WI), according to the manufacturer’s protocol. A HeLa cell line stably expressing histone H2b-mCherry ( Neumann et al., 2010 ) was maintained at 500 ng/ml puromycin (Invitrogen, Carlsbad, CA). The mycoplasma contamination was tested by PCR every 2 or 3 months and was always negative. Cells were cultured on 2-well Lab-Tek Chambered Coverglass (Thermo Fisher Scientific, Waltham, MA) for live-cell imaging. For correlative light–electron microscopy, cells were grown on sapphire disks (0.05 mm thick, 3 mm diameter; Wohlwend GmbH, Sennwald, Switzerland), which had been carbon-coated in order to relocate cells on electron microscopy (EM) grids, and synchronized by double thymidine arrest ( Harper, 2005 ).
Live-cell imaging
At least 30 min before imaging, the medium was replaced by imaging medium (IM; CO 2 -independent medium without phenol red (Invitrogen) containing 20% FCS, 2 mM l-glutamine, and 100 µg/ml penicillin and streptomycin). Imaging was performed at 37°C in a microscope-body-enclosing incubator. Cells on carbon-coated sapphire disks were observed by confocal microscopy (LSM510Meta or LSM780; Carl Zeiss, Oberkochen, Germany) using 10 × 0.3 NA Plan-Neofluar or 20 × 0.8 NA Plan-Apochromat objective (Carl Zeiss). The cell division process was monitored every 24 s by time-lapse imaging. For three-dimensional (3D) time-lapse imaging, cells were observed by confocal microscopy (LSM780) using 63 × 1.4 NA Plan-Apochromat objective (Carl Zeiss). For Figure 1—figure supplement 1 , fluorescent chromatin and Lap-2α were recorded under the following conditions: 25 optical sections, section thickness of 2.0 µm, z-stacks of every 1.0 µm, the xy resolution of 0.13 µm, and a time-lapse interval of 30 s. For Figure 3—figure supplement 2 , fluorescent chromatin was monitored under the following conditions: 40 optical sections, section thickness of 1.4 µm, z-stacks of every 0.7 µm, the xy resolution of 0.13 µm, and a time-lapse interval of 10 min. For Figure 4 , DNA was stained with 0.2 µM silicon–rhodamine Hoechst ( Lukinavicius et al., 2015 ), and the nucleus and nucleoporins were monitored under the following conditions: 25 optical sections, section thickness of 2.5 µm, z-stacks of every 1.25 µm, the xy resolution of 0.25 µm, and a time-lapse interval of 1 min. Fluorescence images were filtered with a median filter (kernel size: 0.25 × 0.25 µm) for presentation purposes. Segmentation of the nucleus and core regions A 3D computational pipeline was developed in MATLAB (The MathWorks Inc., Natick, MA) that segments chromosomes and core regions from H2B-mCherry and Lap-2α-YFP channels, respectively and extracts different parameters. Original stacks were interpolated along z axis to obtain isotropic resolution and facilitate true 3D image analysis. A 3D Gaussian filter was applied to reduce the effects of high frequency noise. To detect chromosome regions, H2B-mCherry and SiR-Hoechst channels were binarized first using a multi-level thresholding method as described in Heriche et al. (2014) . Then, chromosome region of interest typically in metaphase in the first time point of the sequence was detected by analyzing the volume and location information of the connected components in the binary image. The detected chromosome was then tracked over the subsequent time points of the sequence and both of the daughter chromosomes were tracked after the division. The surface area of the chromosome was computed applying the method described in Legland et al. (2007) . For Lap-2α-YFP channel, a reference threshold was estimated by analyzing the intensity over time. This reference threshold was then adapted with a second threshold obtained from individual time points in order to segment the protein. The portion of the nuclear surface where Lap-2α localizes was marked to estimate the surface area of the core regions. Inner- and outer-core regions within nuclei were determined by dividing each nucleus with a cutting plane. The cutting plane was constructed from two vectors where the first one was directed towards the maximum elongation of nucleus and the second one was orthogonal to the first vector and was directed towards the upward z direction. These axes were determined by Eigen vector analysis on the pixel coordinates of the detected nucleus. For the measurement of the Nup intensity on the NE, segmented nuclear volume was dilated and eroded in 3D to define a nuclear membrane rim with 0.75 µm width. The areas of inner- and non-core regions were adjusted in individual time points based on the total surface area of the nuclei. Visualization of the chromosome surface in 3D was done in the Amira software package ( Pruggnaller et al., 2008 ).
Sample preparation for electron microscopy
Cells at different cell-cycle stages were instantly frozen using a high-pressure freezing machine (HPM 010; ABRA Fluid AG, Widnau, Switzerland). Just before freezing, cells were immersed in IM containing 20% Ficoll (PM400; Sigma Aldrich) for protecting cells from freezing damage. Freeze substitution into Lowicryl HM20 resin (Polysciences Inc., Warrington, PA) was performed as described in a previous report ( Kukulski et al., 2011 ), with the following modifications: Frozen cells were incubated with 0.1% uranyl acetate (UA) in acetone at -90°C for 20–24 hr and, after infiltration into Lowicryl resin and UV-polymerization, samples were further polymerized by sunlight for 3–4 days. The cells were also embedded in EPON resin (Serva, Heidelberg, Germany) for enhancing membrane contrast as follows: Frozen cells were incubated with 1.0% osmium tetroxide (OsO 4 ), 0.1% UA, and 5% water in acetone at −90°C for 20–24 hr. The temperature was raised to −30°C (5°C/hour), kept at −30°C for 3 hr, and raised to 0°C (5°C/hr). Samples were then washed with acetone, infiltrated with increasing concentrations of EPON in acetone (25, 50 and 75%), embedded in 100% EPON and polymerized at 60°C for 2 days. Sections of 300 nm and 50 nm thickness were cut with a microtome (Ultracut UCT; Leica, Wetzlar, Germany) and collected on copper–palladium slot grids (Science Services, München, Germany) coated with 1% Formvar (Plano, Wetzlar, Germany).
Electron tomography
As fiducial markers, 15 nm of gold-conjugated Protein A (CMC university Medical Center Utrecht, Utrecht, Netherlands) was absorbed on both sides of 300 nm sections. Sections were post-stained with 2% UA and lead citrate. Single or dual axis tilt series were acquired with a TECNAI TF30 transmission EM (TEM; 300 kV; FEI, Hillsboro, OR) equipped with a 2k x 2k Eagle camera (FEI) by using the Serial EM software ( Mastronarde, 2005 ). The samples were pre-irradiated by an electron beam to minimize sample shrinkage during tilt series acquisition. Images were recorded over a −60° to 60° tilt range with an angular increment 1° at a pixel size of typically 0.75 nm or 1.0 nm. Tomograms were reconstructed using R-weighted backprojection method implemented in the IMOD software package (version 4.5.6) ( Kremer et al., 1996 ). Dual axis tilt series were aligned using gold fiducial markers while single axis tilt series were aligned by patch tracking. It should be noted that tomographic resolution permits great advantages over classical approaches in which the thickness of a section is in the range of the diameter of a nuclear pore and it is thus not clear which parts of it are within the section and into which exact direction they are projected into in the electron micrograph. In contrast, 3D data permit a much more accurate mapping of orientation, membrane topology and substructures for each individual NPC, which is essential to study rare intermediates.
Immuno-electron microscopy
Grids carrying 50 nm sections were pretreated with 0.1% Trition X-100 (Sigma Aldrich) in phosphate-buffered saline (PBS) for 10 min and blocked with 1% BSA and 0.1% fish skin gelatin (Sigma Aldrich) in PBS for 1 hr. Sections were then incubated with a primary antibody mAb414 (Covance, Princeton, NJ; RRID: AB_10063490 ), which recognizes four nucleoporins (Nups 358, 214, 153, and 62), for 2 hr, a rabbit anti-mouse secondary antibody (Cat. No. Z0259; Dako, Hamburg, Germany; RRID: AB_2532147 ) for 1 hr, and 10 nm of gold-conjugated Protein A (CMC university Medical Center Utrecht) for 30 min. The antibodies and Protein A beads were diluted in PBS with 0.2% BSA and the sections were washed for five times with PBS containing 0.2% BSA between steps. After multiple washes with PBS, sections were fixed in 2.5% glutaraldehyde in PBS for 20 min in order to immobilize the antibodies and Protein A-gold beads on sections. After washing with water, sections were post-stained with 2% UA and lead citrate for contrast enhancement. All steps were carried out at room temperature. Images were taken on a TEM (CM 120 Biotwin; Phillips, Hillsboro, OR). For specificity analysis of immuno-EM labeling, the number of gold particles on assembly intermediates and ones nonspecifically attached within 50 nm under the inner nuclear membrane was counted.
Cryo-electron tomography of isolated nuclear envelope
The nuclear envelope of HeLa cells was isolated and cryo-fixed as described previously ( Bui et al., 2013 ; Ori et al., 2013 ). Tilt series of cryo-EM images were acquired using a Titan Krios TEM (FEI) at a pixel size of 0.34 or 0.43 nm and tomograms were reconstructed using the IMOD software package as described in ( Bui et al., 2013 ). Membrane profile analysis and measurement of nuclear pore diameter The outlines of outer and inner nuclear membrane (ONM and INM) were manually marked by clicking points within the tomographic volume in the IMOD software package. The sets of clicked points were aligned to share an x-axis corresponding to INM and interpolated using a spline fit, and the resulting coordinates were fitted locally using a second degree polynomial fit as described in Kukulski et al. (2012) . The maximum depth of the INM evagination was determined from these two-dimensional profiles. For the ONM/INM distance, the median of the distance at 50 points between 45 and 90 nm away from mature pores was measured. The alignment, the interpolation, and the extraction of the parameter were done in MATLAB 7.4. The maximum diameter of assembly intermediates and mature pores was measured manually from the top view images as illustrated in Figure 2D . The mature pores used for the measurement were the ones found in cells at >3 hr post anaphase. Unpaired t-tests with the assumption of equal variances were performed to compare two groups.
Measurement of nuclear pore density
The number of mature pores and intermediates was counted manually in the tomograms. The nuclear surface area was measured in each tomogram by manually tracing the NE using the IMOD software package. The shrinkage of the specimen was corrected by comparing the diameter of mature pores in EM tomograms of plastic resin with the one in cryo-EM tomograms. The shrinkage was 22 ± 2.7% (the average and standard deviation, N = 13 sections) and 15 ± 2.8% ( N = 11 sections) in Lowicryl and EPON resin, respectively. Since non-core and core regions are hard to distinguish in the matured NE after late G1, the pore density in cells >3 hr post anaphase was measured in any regions of the NE. Kinetic modeling of nuclear pore density is described in Materials and methods. Kinetic modeling of nuclear pore densities We modeled pore maturation using delay equations ( Figure 3—figure supplement 1A ). Assembly intermediates are generated with a rate V(t ) and enter maturation with a rate constant k M . After a time interval K M an intermediate becomes fully matured to a NPC. We denote by τ S the time required post anaphase to seal the NE and end the postmitotic assembly of the NPC. The simulation time t is related to the time after anaphase onset t A O by t = t A O − τ S . For the data shown in Figure 3C,D we took τ S = 10 min by assuming a start of interphase assembly to be 10 min after anaphase onset when the NE is sealed ( Dultz et al., 2008 ; Otsuka et al., 2014 ). We simulated the process for τ S = 0‒15 min, and found that τ S + τ M differed by less than 1%. The number of intermediates I and mature pores M is given by (1) d I ( t ) d t = V ( t ) − k M I ( t ) (2) d M ( t ) d t = k M I ( t − τ M ) − k d M ( t ) , where k d is the degradation rate constant of mature pores. Consequently the number of intermediates in the process of maturation I m is given by (3) d I m ( t ) d t = k M I ( t ) − k M I ( t − τ M ) . The total number of intermediates I T is the quantity we can measure which is given by (4) I T ( t ) = I ( t ) + I m ( t ) . Surface densities are computed from i T = I T / A , m = M / A , where A is the nuclear surface area. The overall maturation time is defined as (5) T M = 1 k M + τ M We assume isotropic expansion of the nucleus where the surface area can be described by A ( t A O ) = a 0 + a 1 ( 1 − e x p ( − k g 1 t A O ) ) + k g 2 t A O We obtained a 0 = 424 µm 2 (95% confidence interval (CI) [212‒448]), a 1 = 161 µm 2 (95% CI [81‒185]), k g 1 = 0.0722/min (95% CI [0.036‒0.093]), k g 2 = 0.397/min (95% CI [0.199‒0.405]) by fitting Equation 6 to the data in Figure 3—figure supplement 2 . We tested different intermediate production variants ( Figure 3—figure supplement 1B ) as (7) V ( t ) = { v A ( t ) , V a r i a n t 1 ( v 1 e x p ( − k v ( t − t S ) ) + v 0 ) A ( t ) , V a r i a n t 2 i ( t S ) A ( t S ) δ ( t − t s ) + v 0 A ( t ) , V a r i a n t 3. Variant 1 assumes a constant production rate density; Variant 2 assumes a time dependent production that decreases with time to a basal rate v 0 ; finally in Variant 3 the majority of pores are initiated at t S . For Variant 3 the initial densities i(t S ) and m(t S ), are estimated for the inner- and outer-core regions separately. The value of i(t S ) is set to 0 for Variant 2. We take i m (t S ) = 0. The system of equations ( Equations 1‒6 ) is solved analytically to obtain the densities of intermediates and mature pores. The production and degradation rates are estimated from this and previous studies. For the mature pore degradation rate constant we take k d = 0.00042/min, which yields a pore life time of ~40 hr ( Rabut et al., 2004 ; Schwanhausser et al., 2011 ). For Variant 2 and Variant 3 we take v 0 = 0.0015 intermediates/µm 2 /min. This yields an NPC density in mature NEs (3‒20 hr post anaphase) of 11.47 ± 1.33 NPCs/µm 2 (0.65 ± 6e-4 intermediates/µm 2 ) for Variant 3 and 12.1 ± 1.2 NPCs/µm 2 (0.41 ± 1.36e-04 intermediates/µm 2 ) for Variant 2. Here the mean and standard deviation were estimated from inner-core*0.68 + outer-core*0.32 since the ratio of the surface area between inner- and outer-core regions is 0.68:0.32. The other model parameters are estimated by minimizing the sum of squared residuals (MATLAB routine lsqnonlin ) (8) F = 1 σ 2 ∑ j = 1 n / 2 ( i T ( t j ) − D i ( t j ) ) 2 + ( m ( t j ) − D m ( t j ) ) 2 , where D i and D m are the measured densities of intermediate and mature pores ( Figure 3C,D ), n is the number of data points, and σ 2 = 2.18 pores/µm 2 is the mean standard deviation estimated from all measurements. For Variant 1 we obtained k M = 7.13/min (95% CI [0.0379‒7.5730]), τ M = 18.23 min (95% CI [0.725*‒27.59]) and T M = 18.37 min (95% CI [16.12‒27.69]), for Variant 2 k M = 0.0996/min (95% CI [0.0274‒2.06]), τ M = 17.75 min (95% CI [0.725*‒44.59]) and T M = 27.78 min (95% CI [18.26‒44.72]), for Variant 3 k M = 1.357/min (95% CI [0.0408‒20*]), τ M = 43.03 min (95% CI [18.78‒49.86]) and T M = 43.76 (95% CI [41.32‒50]). For Variant 2 and 3 the model fit does not change for very low values τ M or high values of k M , respectively. The asterisk indicates that the 95% boundary of the distribution has not yet been reached at the given value. The profile-likelihood method ( Venzon and Moolgavkar, 1988 ) has been used to estimate the 95% confidence. In this method the log-increase φ ( p a r ) = n [ l o g ( F ( p a r ) n ) − l o g ( F ( p a r m i n ) n ) ] of the mean squared distance F with respect to the best fit par min was computed by varying the parameter of interest and optimizing the other parameters to the n data points. For | φ ( p a r ) | < χ 1 , 0.95 2 = 3.84 the parameter is within its 95% CI. For T M ( Equation 5 ) the confidence interval is computed from the values of k M and τ M . The quality of the fits (lower sum of squared residuals, Figure 3—figure supplement 1C ) was slightly better for Variant 3. Furthermore the obtained maturation time was more in agreement with previous reported values ( Dultz and Ellenberg, 2010 ). We thus investigate alternatives to the maturation mechanism using Variant 3 only. The model with a multi-step maturation process ( Figure 3—figure supplement 1F ) reads (9) d I 1 d t = V ( t ) − k M 1 I 1 (10) d I j d t = k M ( j − 1 ) I j − 1 − k M j I j , for j = 2 , . . . , N − 1 (11) d M d t = k M ( N − 1 ) I N − 1 − k d M . The sum of all intermediates ∑ j = 1 N − 1 I j / A and M/A are fitted to the intermediate and mature pore densities, respectively. We modeled Variant 3 for the pore initiation. We found that there was no significant difference in the quality of the fits when assuming equal transition rate constants. Consequently the simulations shown are for k M j = k M . The maturation time defined as the characteristic time of mature pore appearance reads (12) T M = ∑ j = 1 N − 1 1 k M j = ( N − 1 ) k M . We simulate different maturation times by allowing a maturation time distribution P ( τ ) , with finite positive support as (13) d I ( t ) d t = V ( t ) − k M I ( t ) (14) d I m ( t ) d t = k M I ( t ) − k M ∫ 0 ∞ P ( τ ) I ( t − τ ) d τ (15) d M ( t ) d t = k M ∫ 0 ∞ P ( τ ) I ( t − τ ) d τ − k d M ( t ) . The example shown in Figure 3—figure supplement 1H is for an uniform distribution of τ M ± w , where w is the half-width of the distribution.
Genome editing
For tagging Nup107 at the N-terminus with monomeric enhanced GFP (mEGFP), zinc finger nucleases (ZFN) containing DNA binding sequences in the 5’-3’ direction of TCAGTACTGATG and GCTGAGCCCGAAGTC were purchased from Sigma Aldrich. The donor plasmid consists of mEGFP cDNA sequence flanked by a left homology arm (ENSEMBL release 75, ENST00000229179, chromosome 12: 68686269–68687065) and a right homology arm (ENSEMBL release 75, ENST00000229179, chromosome 12: 68687065–68687892). ZFN and the donor plasmid were transfected into HeLa cells as described in Mahen et al. (2014) . For tagging Nup358 at the N-terminus with mEGFP, CRISPR-Cas9 nickases were used. pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) was a gift from Feng Zhang (Addgene plasmid # 42335, Cambridge, MA), and gRNAs were designed using the Feng Zhang Lab’s Target Finder ( http://crispr.mit.edu/ ). The following gRNAs for Nup358 were cloned into pX335 ( Cong et al., 2013 ): 5’CCTGAGCGCTGGTCTCACGCGCC3’ and 5’GAGGCGCAGCAAGGCTGACGTGG3’. CRISPR-Cas9 nickases and the donor plasmid were transfected using jetPRIME reagent (Polyplus, New York, NY), according to the manufacture’s protocol. 7–10 days after transfection, cells were sorted with a MoFlo Legacy cell sorter (Beckman Coulter, Brea, CA) as described in Mahen et al. (2014) . Junction PCR Genomic DNA was prepared using ISOLATE II Genomic DNA Kit (Bioline, Taunton, MA) according to the supplier’s manual. Junction PCR was performed at endogenous loci to detect the insertion of mEGFP using separate sets of primers, one of which anneals inside mEGFP and the other one outside of the gene of interest. The primer sequences are as follows: Nup107 forward (5’ATTAATAAAAGGTATAAATGCCAGCAACAG3’), Nup107 reverse (5’CACCTGGTCAACAACTACTTACTCCT3’), NUP358 forward (5’GCATAAGACGGTGGTTCTGGAACCAATC3’), and NUP358 reverse (5’AGCAAACTGACTCAAGATTCTGCGCA3’). Touchdown PCR was performed using HotStar HiFidelity (Qiagen, Hilden, Germany) according to the supplier’s protocol.
Western blot
Cells were lysed for 20 min on ice in lysis buffer (10% glycerol, 1 mM DTT, 0.15 mM EDTA, 0.5% Triton X-100, complete protease inhibitor cocktail and PhosSTOP (Roche, Basel, Switzerland)). Protein concentration was quantitated using the Bio-Rad Protein Assay (Bio-Rad, Hercules, CA). 40 µg of total protein was run onto NuPAGE ® 4–12% Bis-Tris Gels (Novex Life Technologies, Waltham, MA) and transferred onto PVDF membrane using the Bio-Rad transfer system. After blocking with 5% milk solution (nonfat milk powder in PBS + 0.1% Tween 20), the following primary antibodies were used to label the proteins of interests: anti-Nup107 (ab178399, abcam, Cambridge, United Kingdom; RRID: AB_2620147 ), anti-RanBP2 (ab197044, abcam; RRID: AB_2620148 ), anti-tubulin (DM-1A, Sigma; RRID:AB_521686) and anti-GFP (Cat. No. 11814460001, Roche; RRID: AB_390913 ). Subsequently horseradish peroxidase (HRP)-conjugated secondary antibodies (ECL anti-rabbit IgG HRP-linked whole antibody NA934V; RRID: AB_772206 , or ECL anti-mouse IgG HRP-linked whole antibody NA931V; RRID: AB_772210 , GE Healthcare, Little Chalfont, United Kingdom) were used to detect the protein of interests with chemiluminescence reaction.
Kinetic analyses of Nup107 and Nup358 assembly
Average intensities of Nup358 and Nup107 in the inferred inner-core and non-core regions were quantified. The total intensities were calculated by multiplying the average intensities by the nuclear surface area. Methods for the segmentation of core regions is described in ‘Segmentation of the nucleus and core regions’ section above. We formulated a sequential assembly model that describes the recruitment of Nup107 and Nup358. Nup107 accumulates first with a rate constant k , and Nup358 assembles later with a rate constant l . The number of NPC intermediates can be described as (16) d N 0 x d t = − k x N 0 x (17) d N 1 x d t = k x N 0 x − l x N 1 x , where x = p m , i p (18) d N 2 x d t = l x N 1 x , where N 0 , 1 , 2 p m , i p denote the number of NPCs that assemble through the interphase ( ip ) or postmitotic ( pm ) pathway without Nup107 nor Nup358 ( N 0 p m and N 0 i p ), with Nup107 only ( N 1 p m and N 1 i p ), or both Nup107 and Nup358 ( N 2 p m and N 2 i p ). The rate constants for postmitotic and interphase recruitment of Nup107 and Nup358 are given by k pm and k ip , and l pm and l ip , respectively. The degradation and interphase production rates are small ( Rabut et al., 2004 ; Dultz and Ellenberg, 2010 ; Schwanhausser et al., 2011 ) and can be neglected in the time frame of 2 hr post anaphase (see also ‘kinetic modeling of nuclear pore densities’ above). The total number of NPCs containing Nup107 and Nup358 are then given by (19) T N u p 107 = [ ( N 1 p m + N 2 p m ) f p m + ( N 1 i p + N 2 i p ) ( 1 − f p m ) ] (20) T N u p 358 = [ N 2 p m f p m + N 2 i p ( 1 − f p m ) ] where f pm is the fraction of postmitotic NPC. In the non-core region f pm = 0.92, whereas in the inner-core region f pm = 0.5 ( Figure 3 ). Since the nuclear membrane is not yet sealed before 10 min post anaphase ( Dultz et al., 2008 ; Otsuka et al., 2014 ), we take for initial condition N 0 i p ( t = 10 min) = 1, and 0 for t < 10 min. For the postmitotic assembly we take N 0 p m ( t = 4 min) = 1, and 0 for t < 4 min. The four kinetic rate constants k pm , k ip , l pm and l ip are estimated by simultaneously fitting the total Nup107 and Nup358 intensities in non-core and inner-core regions from 4 min up to 125 min post anaphase ( Figure 4 ). To match the experimental data normalization we also normalize the simulations. The normalization coefficients range from 1‒1.1. The normalized pore densities are obtained by multiplying the normalized total number of pores by the nuclear surface area and subsequently dividing it by the maximal area. We obtained k pm = 0.355/min (95% CI [0.333‒0378]), l pm = 0.0437/min (95% CI [0.0425‒0.0449]), k ip = 0.0374/min (95% CI [0.0335‒0.0417]), and l ip = 0.0276/min (95% CI [0.0209‒0.0354]). Confidence intervals are obtained as explained in ‘kinetic modeling of nuclear pore densities’ above. Stimulated emission depletion (STED) microscopy After release from thymidine block, the division process of GFP-Nup107 genome-edited cells were monitored every 30 s by confocal microscopy (LSM780; Carl Zeiss) using 10 × 0.3 NA Plan-Neofluar objective (Carl Zeiss). Cells were then fixed with paraformaldehyde and immunostained as described in the previous report ( Szymborska et al., 2013 ), with rabbit anti-Nup358 (Cat. No. HPA018437, The Human Protein Atlas; RRID: AB_2620151 ) and mouse anti-GFP (Cat. No. 11814460001, Roche; RRID: AB_390913 ) antibodies, and Abberior STAR RED-conjugated anti-rabbit IgG (Cat. No. 2-0012-011-9, Abberior GmbH, Göttingen, Germany; RRID: AB_2620152 ) and Abberior STAR 580-conjugated anti-mouse IgG (Cat. No. 2-0002-005-1, Abberior GmbH; RRID: AB_2620153 ). Cells were mounted in Vectashield containing 4',6-diamidino-2-phenylindole (DAPI) (Cat. No. H-1500, Vector Laboratories Inc., Burlingame, CA). Super-resolution imaging was performed on a Leica SP8 3X STED microscope, equipped with 775 nm pulsed wave depletion and white light pulsed lasers, Leica HCX 100 × 1.4 NA Plan Apochromat objective, and time-gated hybrid detectors (Leica HyD). Excitation wavelength was adjusted to 580 and 633 nm, and bandpass filters were set to 585−630 and 650−702 nm, and the two channels were recorded pseudo-simultaneously by line switching. The fluorescent nuclei stained with DAPI were also recorded afterwards. The images were taken with a final optical pixel size of 20 nm, z-stacks of every 200 nm, and the optical section thickness of 550 nm. Images were filtered with a Gaussian filter (kernel size: 0.5 × 0.5 pixel) for presentation purposes.
Quantification of STED data
Lines with the width of 400 nm were drawn along the edge of the DAPI-stained nuclei. Non-core and core regions were inferred as described in Figure 1—figure supplement 1B‒G . The NEs on the lines were flattened and fluorescence intensity was quantified after binning of 15 pixels (correspond to 300 nm width) along the lines. The intensity difference between two channels was normalized using the images in non-core regions, and the intensity ratio of Nup107 to Nup358 was measured. All analyses were done in ImageJ ( http://rsbweb.nih.gov/ij/ ). Particle averaging of mature pores and pore intermediates Assembly intermediates which have similar membrane profiles were selected at each time point and subjected to subtomogram averaging. The averaging was done on nuclear pores in freeze-substituted and plastic-embedded cells using the previously described averaging method ( Beck et al., 2004 ). Briefly, the subtomograms, which contain mature pores and intermediates, were extracted from the tomograms. The extracted subtomograms were aligned using iterative missing wedge compensation alignment procedure. Afterwards, the aligned subtomograms were averaged and visualized. The mature pores used for the averaging are the ones found in cells at >3 hr post anaphase. The overall structural similarity of the averaged nuclear pores to the respective cryo structures ( Figure 1E ) indicates a good structure preservation in freeze-substituted and plastic-embedded cells.
Sample size determination and statistical analysis
For correlative light and electron microscopy, we first obtained one tomogram in each non-, inner- and outer-core region in 4 different cells at 19, 28, 53, and 116 min after anaphase onset as pilot experiments. We then increased the number of dataset and eventually took 158 tomograms in 14 different cells. The exact value of the analyzed surface area and the number of nuclear pores found are listed in Table 1 . We picked up all the NE evaginations which were visible in the EM tomograms and did not perform any selection. Statistical analyses of the pore structure and density were performed only after all the data were taken. For immuno-EM, time-lapse 3D imaging, and STED microscopy, the data were from two independent experiments and the statistical analysis was carried out after all the data were obtained. Statistical analysis methods, sample sizes (N) and P values (P) for each experiment are indicated in figure legends.
📊 Figures
Figure 1.
Interphase assembly intermediates of nuclear pore complexes (NPCs).
( A ) Correlative live-cell imaging with electron microscopy (EM). Cell-cycle progression of HeLa cells was monitored by confocal microscopy and the same cell was subjected to electron tomography. Tom...
Figure 1u2014figure supplement 1.
Estimation of core regions.
( A , B ) Time-lapse three-dimensional (3D) imaging of dividing HeLa cells which express Lap-2u03b1-YFP and histone-H2b-mCherry by confocal microscopy. Scale bars, 10 u00b5m. ( A ) Maximum intensity p...
Figure 1u2014figure supplement 2.
Live-cell and EM images of cells analyzed by EM tomography.
Cells cultured on carbon-patterned sapphire disks were imaged by confocal microscopy (upper panels). After high-pressure freezing, plastic-embedding, and serial sectioning, the same cells were observe...
Figure 1u2014figure supplement 3.
Galleries of interphase NPC assembly intermediates.
( A ) Other images of immuno-EM in Figure 1C . Assembly intermediates are indicated by white arrows. The profile of the nuclear envelope (NE) and the positions of gold particles in one EM image are de...
Video 1.
EM tomographic slices of the nuclear envelope of a cell at 53 min post anaphase.
One of the mature pores and an assembly intermediate are indicated by blue and red arrows, respectively. Scale bar, 100 nm. DOI: http://dx.doi.org/10.7554/eLife.19071.008
Figure 2.
Quantitative structural comparison of assembly intermediates.
( A ) Electron tomographic slices of assembly intermediates in cells captured at 53, 28, and 19 min after anaphase onset (AO) and ONM/INM fusion events. Profiles of ONM (gray) and INM (blue) in black ...
Figure 3.
Abundance of mature pores and assembly intermediates at different cell-cycle stages.
( A ) Measurement of nuclear pore density. Gray sheets are the NEs segmented from EM tomograms. Blue and red dots indicate the positions of mature pores and intermediates, respectively. Inner-core reg...
Figure 3u2014figure supplement 1.
Modeling the density of nuclear pores.
( A ) Reaction scheme of the delay equation model ( Equations 1u20123 ). V , production rate; K M , maturation initiation rate constant; u03c4 M , maturation delay; K d , degradation rate constant. Th...
Figure 3u2014figure supplement 2.
Nuclear surface area measurement for the modeling.
( A ) Time-lapse 3D imaging of dividing HeLa cells which express histone-H2b-mCherry (indicated in red). Images show single confocal sections (upper) and the segmented nuclei (lower) at indicated time...
Figure 4.
Live imaging of nuclear pore assembly in core regions.
( A ) Time-lapse three-dimensional (3D) imaging of GFP-Nup107 and GFP-Nup358 genome-edited cells. DNA was stained with siliconu2013rhodamine (SiR) Hoechst ( Lukinavicius et al., 2015 ). Single confoca...
Figure 4u2014figure supplement 1.
Characterization of genome-edited cell lines expressing GFP-Nup107 and GFP-Nup358.
( A ) Junction PCR of GFP-Nup107 (left) and GFP-Nup358 (right) cells with forward primers annealing the upstream of Nups and reverse primers annealing inside of Nups as indicated by black arrows in th...
Figure 5.
Stimulated emission depletion (STED) imaging of assembly intermediates.
GFP-Nup107 genome-edited cells were stained with anti-GFP and anti-Nup358 antibodies. ( A ) STED images of cells at 24 and 108 min after anaphase onset. Scale bar, 10 u00b5m. ( B ) Flattened and enlar...
Figure 6.
3D structural comparison of assembly intermediates.
( A , B ) Electron tomographic slices of single ( A ) and averaged ( B ) mature pores and intermediates at selected time points (53, 28, and 19 min). The averaged images are from 36 mature pores and 1...
Figure images are served from the NIH/NLM PubMed Central Open Access Subset or Europe PMC; copyright remains with the publishers and authors.
💬 Discussion
0 commentsNo comments yet. Be the first to start a discussion!
Leave a Comment